View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_130 (Length: 232)
Name: NF8986_low_130
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_130 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 213
Target Start/End: Original strand, 42648026 - 42648098
Alignment:
| Q |
141 |
ctgctttttcaatcatgtgtattcctctgatcttagcaaattattgtgcagattcacaggcatcactgtactt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42648026 |
ctgctttttcaatcatgtgtattcctctgatcttagcaaatttttgtgcagattcacaggcatcactgtactt |
42648098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 142
Target Start/End: Original strand, 42647170 - 42647199
Alignment:
| Q |
113 |
attagtgcagatttaacatctaaccatact |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42647170 |
attagtgcagatttaacatctaaccatact |
42647199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 42647088 - 42647116
Alignment:
| Q |
1 |
attttctcaaccattttgtgctttgtagg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42647088 |
attttctcaaccattttgtgctttgtagg |
42647116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 65
Target Start/End: Complemental strand, 38387928 - 38387893
Alignment:
| Q |
30 |
cactgtagaactatatagtgctttgtatattacata |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38387928 |
cactgtagaactatatagtgctttgtatattacata |
38387893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 38387982 - 38387954
Alignment:
| Q |
1 |
attttctcaaccattttgtgctttgtagg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38387982 |
attttctcaaccattttgtgctttgtagg |
38387954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University