View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8986_low_148 (Length: 215)

Name: NF8986_low_148
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8986_low_148
NF8986_low_148
[»] chr3 (1 HSPs)
chr3 (16-166)||(7037674-7037824)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 166
Target Start/End: Complemental strand, 7037824 - 7037674
Alignment:
16 tggacatcaggcctatatccttgattgtgtgtatctacaaggttttagcaaaagtgttggctaatatattagaaaaggtacccggtacagtcatatcaga 115  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7037824 tggacttcaggcctatatccttgattgtgtgtatctacaaggttttagcaaaagtgttggctaatatattagaaaaggtaaccggtacagtcatatcaga 7037725  T
116 gacacagttggctttcatattcggtagaatatttttggataggatccttat 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
7037724 gacacagttggctttcatattcggtagaatatttttggataggatccttat 7037674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University