View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_149 (Length: 215)
Name: NF8986_low_149
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_149 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 166
Target Start/End: Complemental strand, 7037824 - 7037674
Alignment:
| Q |
16 |
tggacatcaggcctatatccttgattgtgtgtatctacaaggttttagcaaaagtgttggctaatatattagaaaaggtacccggtacagtcatatcaga |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7037824 |
tggacttcaggcctatatccttgattgtgtgtatctacaaggttttagcaaaagtgttggctaatatattagaaaaggtaaccggtacagtcatatcaga |
7037725 |
T |
 |
| Q |
116 |
gacacagttggctttcatattcggtagaatatttttggataggatccttat |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7037724 |
gacacagttggctttcatattcggtagaatatttttggataggatccttat |
7037674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University