View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_153 (Length: 210)
Name: NF8986_low_153
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_153 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 2 - 195
Target Start/End: Complemental strand, 42039202 - 42039009
Alignment:
| Q |
2 |
ttatttgtcactttagaatatnnnnnnntattaagagtaggatggaacctgcggctattcctagaagatcgtcttcagatatgattgctctaggaatttt |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
42039202 |
ttatttgtcactttagaatataaaaaaatattaagagtaggatggaacctgcggctattcctagaagatcgtcttcagagacgattgctctaggaatttt |
42039103 |
T |
 |
| Q |
102 |
ttgagcaattttattttcccacaaagaagcaagctcattcatgctgtaacagttggtagagggtcgaaaatgaacacttttgttgattgttctt |
195 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42039102 |
tcgagcaattttattttcccacaaagaagcaagctcattcatgctgtaacagttggtagagggtcgaaaatgaacacttttgttgattgttctt |
42039009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University