View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_155 (Length: 205)
Name: NF8986_low_155
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_155 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 42224200 - 42224023
Alignment:
| Q |
16 |
aaattgatgccacaacatttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatacgttgaatccaggcccaaacatgacaacccaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224200 |
aaattgatgccacaacatttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatacgttgaatccaggcccaaacatgacaacccaga |
42224101 |
T |
 |
| Q |
116 |
tcaattttttccaacaagtcataaaagacaaagtgtacacagcctcagacatcaataattcagttgctcttgtctctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224100 |
tcaattttttccaacaagtcataaaagacaaagtgtacacagcctcagacatcaataattcagttgctcttgtctctg |
42224023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 32 - 83
Target Start/End: Original strand, 26335935 - 26335986
Alignment:
| Q |
32 |
atttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatac |
83 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
26335935 |
atttgaagtatgggatgaactttgcatatggtggtacaggtgtatttgatac |
26335986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 32 - 113
Target Start/End: Original strand, 26322918 - 26322999
Alignment:
| Q |
32 |
atttgaaatatggaatgaactttgcatttggtggtactggtgtgtttgatacgttgaatccaggcccaaacatgacaaccca |
113 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||| || ||||| |||||||| || | | |||| ||||| |||||| |||| |
|
|
| T |
26322918 |
atttgaagtatgggatgaactttgcatatggtggcacaggtgtatttgatacatttacttcaggaccaaatatgacagccca |
26322999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University