View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_42 (Length: 544)
Name: NF8986_low_42
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 346; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 168 - 529
Target Start/End: Original strand, 7722749 - 7723110
Alignment:
| Q |
168 |
cctctctttctctttctttatctttatgatctttctactagtataaattgaaactatgcattatgcaagaagaaatcaaaatcatacatgaagggtgtca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7722749 |
cctctctttctctttctttatctttatgatctttctactagtataaattgaaactatgcattattcaagaagaaatcaaaatgatacatgaagggtgtca |
7722848 |
T |
 |
| Q |
268 |
taaacagtagtacttctgcagagatataatagaaactcaaacacttgcttacattacacactcactccctgacttacccttcatttcatttattgcattg |
367 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722849 |
taaacagtagtaattctgcagagatataatagaaactcaaacacttgcttacattacacactcactccctgacttacccttcatttcatttattgcattg |
7722948 |
T |
 |
| Q |
368 |
ggtccctctctctcttatgctctataattttatctcctttactatatatattttgtatttgtatgtacatgtctccatttgcaattcacgacaacgtgga |
467 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722949 |
ggtccctctctctcttatgctttataattttatctcctttactatatatattttgtatttgtatgtacatgtctccatttgcaattcacgacaacgtgga |
7723048 |
T |
 |
| Q |
468 |
ctgcaggtgctgactagtatttcgacattttattatcttcaaacactacaagacaacaattc |
529 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723049 |
ctgcaggtgctgactagtatttcgacattttattatcttcaaacactacaagacaacaattc |
7723110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 13 - 147
Target Start/End: Original strand, 7722589 - 7722723
Alignment:
| Q |
13 |
gcagagatacggatacggacagaggtttttgagacactaataaagcctcgtgatcggagaaaaaccttgcagatagatagatcccttgaagaccgttccc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722589 |
gcagagatacggatacggacagaggtttttgagacactaataaagcctcgtgatcggagaaaaaccttgcagatagatagatcccttgaagaccgttccc |
7722688 |
T |
 |
| Q |
113 |
tctagtcacgtgggctcttttgaccaacccatcat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722689 |
tctagtcacgtgggctcttttgaccaacccatcat |
7722723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University