View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8986_low_68 (Length: 397)
Name: NF8986_low_68
Description: NF8986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8986_low_68 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 84 - 397
Target Start/End: Original strand, 46892136 - 46892449
Alignment:
| Q |
84 |
gcactccacaacctcatcctctccatcctctccctcattatggctattggcacctccctcaccatcctaacccacacccccaacctccgctccaccacca |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46892136 |
gcactccacaacctcatcctctccatcctctccctcattatggctattggcacctccctcaccatcctaactcacacccccaacctccgctccaccacca |
46892235 |
T |
|
| Q |
184 |
tctgtttccctcctcatacccctccaaatggtcccctcttcttttgggcctacatcttctacctctcaaaatatcttgaattcattgacactctcttcat |
283 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892236 |
tatgtttccctcctcatacccctccaaatggtcccctcttcttttgggcctacatcttctacctctcaaaatatcttgaattcattgacactctcttcat |
46892335 |
T |
|
| Q |
284 |
aatcctatcaagatccatcaaacgcctctcattcctccacgtgtaccatcattcaaccgtcccagtcatgtgttatctatggcttaattcttctcaatca |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892336 |
catcctatcaagatccatcaaacgcctctcattcctccacgtgtaccatcattcaaccgtcccagtcatgtgttatctatggcttaattcttctcaatca |
46892435 |
T |
|
| Q |
384 |
ctcttccctattgc |
397 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46892436 |
ctcttccctattgc |
46892449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University