View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8987_low_27 (Length: 274)
Name: NF8987_low_27
Description: NF8987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8987_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 256
Target Start/End: Complemental strand, 55286721 - 55286479
Alignment:
| Q |
14 |
ttggtgttggatattgacatgtgtcaaacatcgtacacgttttctaccagaagtattgatgatagagagattttaaatatagtaatatgtaatgataaag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55286721 |
ttggtgttggatattgacatgtgtcaaacatcgtacacgctttctaccagaagtattgatgctagagagattttaaatatagtaatatgtaatgataaag |
55286622 |
T |
 |
| Q |
114 |
aaacctgaaaacagataaaatcaggggaatgcatcaaaacaagatcaccaatagctttcatcctcttctccaactccaaatcctcacggaaccaaacatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55286621 |
aaacctgaaaacagataaaatcaggggaatgcatcaaaacaagatcaccaatagctttcatcctcttctccaactccaaatcctcacggaaccaaacatt |
55286522 |
T |
 |
| Q |
214 |
gtaactcaaaatcttcaacgaactaacacctttcccagaatca |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55286521 |
gtaactcaaaatcttcaacgaactaacacctttaccagaatca |
55286479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University