View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8987_low_31 (Length: 267)
Name: NF8987_low_31
Description: NF8987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8987_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 2078464 - 2078287
Alignment:
| Q |
16 |
gagcagagaaatgaagttgtgtgaaaaattgaagtgtttggtgataaagaccctttgaaactaaggtttttatatggtctgaaggggaatgtgtggggac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2078464 |
gagcagagaaatgaagttgtgtgaaaaattgaagtgtttggtgataaagacccattgaaactaaggtttttatatggtctgaaggggaatgtgtggggac |
2078365 |
T |
 |
| Q |
116 |
cacactggataggaatcttctggtgatgaatgagatgcaattgcattgcagaggattcaaattcagactcagaatcat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2078364 |
cacactggataggaatcttctggtgatgaatgagatgcaattgcattggagaggattcaaattcagactcagaatcat |
2078287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University