View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8987_low_31 (Length: 267)

Name: NF8987_low_31
Description: NF8987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8987_low_31
NF8987_low_31
[»] chr2 (1 HSPs)
chr2 (16-193)||(2078287-2078464)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 2078464 - 2078287
Alignment:
16 gagcagagaaatgaagttgtgtgaaaaattgaagtgtttggtgataaagaccctttgaaactaaggtttttatatggtctgaaggggaatgtgtggggac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
2078464 gagcagagaaatgaagttgtgtgaaaaattgaagtgtttggtgataaagacccattgaaactaaggtttttatatggtctgaaggggaatgtgtggggac 2078365  T
116 cacactggataggaatcttctggtgatgaatgagatgcaattgcattgcagaggattcaaattcagactcagaatcat 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
2078364 cacactggataggaatcttctggtgatgaatgagatgcaattgcattggagaggattcaaattcagactcagaatcat 2078287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University