View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8987_low_35 (Length: 212)
Name: NF8987_low_35
Description: NF8987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8987_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 17149856 - 17149658
Alignment:
| Q |
17 |
aaaacctttttaaaaatgatttcaagaactattnnnnnnnngtaattatctattttttagtgtgtcatta-----------accaaatttaactaaaata |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17149856 |
aaaacctttttaaaaatgatttcaagacctattaaaaaaaagtaattatctattttttagtgtgtcattactttatcttcaaccaaatttaactaaaata |
17149757 |
T |
 |
| Q |
106 |
gcactataactattttacaactgttatcaagggaatttaaactttgctccttgatgctacatgaccaaactattaaccctaagttgacacagtataatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
17149756 |
gcactataactattttacaactgttatcaagggaatttaacctttgctccttgatgctacatgacaaaactattaaccctaagttgacacattataatc |
17149658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University