View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8988_low_16 (Length: 277)
Name: NF8988_low_16
Description: NF8988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8988_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 44768318 - 44768569
Alignment:
| Q |
10 |
aaacctgcacagaacagcaataacagctccccactgacaggcatcaagctatccgaaacacaccagaaacggggagaaacttgcacagccgc-------a |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44768318 |
aaacctgcagagaacagcaataacagctccccactgacaggcatcaagctatccgaaacacaccagaaacggggagaaacttgcacagccgcaaaccgca |
44768417 |
T |
 |
| Q |
103 |
aaccgcaaaaacctgttgcaaatgcaggcgcaaaacagccaaactgcagtagctgaaagcaccaacagcatatttagtcctttagttaataaataggtta |
202 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44768418 |
aaccgcaaaaacctgctgcaaatacaggcgcaaaacagccaaactgcagtagctgaaagcaccaacagcatatttagtcctttagttaataaataggtta |
44768517 |
T |
 |
| Q |
203 |
tttttcatgatagtttaacgactaaattaatgtgtttttctatagtttaagg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44768518 |
tttttcatgatagtttaacgactaaattaatgtgtttttctatattttaagg |
44768569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 172
Target Start/End: Original strand, 10537471 - 10537516
Alignment:
| Q |
127 |
caggcgcaaaacagccaaactgcagtagctgaaagcaccaacagca |
172 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
10537471 |
caggcgcaaaacagccatactgcagtagctgaaagcagcaacagca |
10537516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 172
Target Start/End: Original strand, 10682161 - 10682206
Alignment:
| Q |
127 |
caggcgcaaaacagccaaactgcagtagctgaaagcaccaacagca |
172 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
10682161 |
caggcgcaaaacagccatactgcagtagctgaaagcagcaacagca |
10682206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University