View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8989_high_10 (Length: 415)
Name: NF8989_high_10
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8989_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 269
Target Start/End: Complemental strand, 24369019 - 24368749
Alignment:
| Q |
4 |
ttgagtggagacttacacacatgtggactttgtcaacggatcatgcagcgaagtgaaaaaatgcaagt-----gtggggtgtcatggatccctcacagtg |
98 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
24369019 |
ttgagtagagacttacacacatgtgaactttgtcaacggatcatgcagcgaagtgaaaaaatgcaagtcaaacgtggggtgtcatggatccctcagagtg |
24368920 |
T |
|
| Q |
99 |
gaaagactgacacattactcgcgtgaatgattggtcaagactgatccatgtaggccacgtcattttgggcagtatgactggtgtttacatgtaaaaattg |
198 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
24368919 |
gaaagactaacacattactcacgtgaatgattggtcaagactgatccacgtagtccacatcattttggacagtatgattggtatttacatgtaaaaattg |
24368820 |
T |
|
| Q |
199 |
tattagtaggctttattcaacatgcacaatcaaagaaatttaggtatactttctctcccaaacaaatttaa |
269 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24368819 |
tattattaggctttattcaacatgcacaatcaaagaaatttaggtatactttctctcccaaacaaatttaa |
24368749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 345 - 403
Target Start/End: Complemental strand, 24368665 - 24368607
Alignment:
| Q |
345 |
ttaagggagaaatctataatgtattaaatgagtgtnnnnnnnttaaaatttcaaatgat |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
24368665 |
ttaagggagaaatctataatgtattaaatgaatgtaaaaaaattaaaatttcaaatgat |
24368607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University