View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8989_high_18 (Length: 256)
Name: NF8989_high_18
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8989_high_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 256
Target Start/End: Original strand, 36451473 - 36451712
Alignment:
| Q |
17 |
cagagaaatatccctcttcagaggatgaatctgatgatgatgaaaggcgtcgtcaattaagccctgttcatagctctccgcgtaaagttgatgttcagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36451473 |
cagagaaatatccctcttcagaggatgaatttgatgatgatgaaaggcgtcgtcaattaagccctgttcatagctctccgcgtaaagttgatgttcagtt |
36451572 |
T |
 |
| Q |
117 |
cccagctaaggtgcagcagaatcatgaaggtagccgtgatcctcaaaggtacgggcccattgttgatcgcggtcgccatacaccacagcctagtgctgat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36451573 |
cccagctaaggtgcagcagaatcatgaaggtagccatgatcctcaaaggtacgggcccattgttgatcgcggtcgccatacaccacagcctagtgctgat |
36451672 |
T |
 |
| Q |
217 |
ggacgtaagccaattggaggtagcaccgttaacaaccata |
256 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36451673 |
ggacgtaagccaattggaggtagtaccgttaacaaccata |
36451712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University