View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8989_high_22 (Length: 210)

Name: NF8989_high_22
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8989_high_22
NF8989_high_22
[»] chr2 (1 HSPs)
chr2 (14-97)||(39554111-39554194)
[»] chr4 (1 HSPs)
chr4 (28-87)||(13162753-13162812)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 97
Target Start/End: Complemental strand, 39554194 - 39554111
Alignment:
14 tttggtggttgaaggcaaaatttgcaaactttgttgtatgttatcatagtttgtggatgtgccattttgtttgtatgggcattg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
39554194 tttggtggttgaaggcaaaatttgcaaactttgttgtatgttatcatagtttgtggatgtgccattttgtttgtttgggcattg 39554111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 87
Target Start/End: Original strand, 13162753 - 13162812
Alignment:
28 gcaaaatttgcaaactttgttgtatgttatcatagtttgtggatgtgccattttgtttgt 87  Q
    |||||||||  |||||||||||||  ||||||||||| |||| ||| |||||||||||||    
13162753 gcaaaatttataaactttgttgtagattatcatagttggtggttgttccattttgtttgt 13162812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University