View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8989_low_52 (Length: 228)

Name: NF8989_low_52
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8989_low_52
NF8989_low_52
[»] chr3 (1 HSPs)
chr3 (1-212)||(55300413-55300624)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 55300624 - 55300413
Alignment:
1 gggggtggtattgaaattgatgttgagggagaagagagaggagggggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55300624 gggggtggtattgaaattgatgttgagggagaagagagaggagggggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtga 55300525  T
101 taacaagaaagggatgagttgtgatgggggtggggatgaggagtggcccaagaggcatcaatgacaagagagtaatcggtaagacctttgtagtaaggac 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
55300524 taacaagaaagggatgagttatgatgggggtggggatgaggagtggcccaagaggcatcaatgacaagagaataatcggtaagacctttgtagtaaggac 55300425  T
201 tactgtgggggg 212  Q
    ||||||||||||    
55300424 tactgtgggggg 55300413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University