View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8989_low_52 (Length: 228)
Name: NF8989_low_52
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8989_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 55300624 - 55300413
Alignment:
| Q |
1 |
gggggtggtattgaaattgatgttgagggagaagagagaggagggggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300624 |
gggggtggtattgaaattgatgttgagggagaagagagaggagggggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtga |
55300525 |
T |
 |
| Q |
101 |
taacaagaaagggatgagttgtgatgggggtggggatgaggagtggcccaagaggcatcaatgacaagagagtaatcggtaagacctttgtagtaaggac |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55300524 |
taacaagaaagggatgagttatgatgggggtggggatgaggagtggcccaagaggcatcaatgacaagagaataatcggtaagacctttgtagtaaggac |
55300425 |
T |
 |
| Q |
201 |
tactgtgggggg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
55300424 |
tactgtgggggg |
55300413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University