View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8989_low_54 (Length: 210)
Name: NF8989_low_54
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8989_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 97
Target Start/End: Complemental strand, 39554194 - 39554111
Alignment:
| Q |
14 |
tttggtggttgaaggcaaaatttgcaaactttgttgtatgttatcatagtttgtggatgtgccattttgtttgtatgggcattg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39554194 |
tttggtggttgaaggcaaaatttgcaaactttgttgtatgttatcatagtttgtggatgtgccattttgtttgtttgggcattg |
39554111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 87
Target Start/End: Original strand, 13162753 - 13162812
Alignment:
| Q |
28 |
gcaaaatttgcaaactttgttgtatgttatcatagtttgtggatgtgccattttgtttgt |
87 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| |||| ||| ||||||||||||| |
|
|
| T |
13162753 |
gcaaaatttataaactttgttgtagattatcatagttggtggttgttccattttgtttgt |
13162812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University