View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8989_low_56 (Length: 209)

Name: NF8989_low_56
Description: NF8989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8989_low_56
NF8989_low_56
[»] chr7 (2 HSPs)
chr7 (32-190)||(27118335-27118493)
chr7 (76-190)||(27117757-27117870)
[»] chr1 (2 HSPs)
chr1 (24-185)||(32239962-32240123)
chr1 (76-188)||(32239435-32239546)
[»] chr4 (2 HSPs)
chr4 (73-185)||(23010951-23011062)
chr4 (76-185)||(53371891-53371999)
[»] scaffold0316 (1 HSPs)
scaffold0316 (76-185)||(3010-3118)
[»] chr3 (1 HSPs)
chr3 (76-185)||(7266612-7266720)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 32 - 190
Target Start/End: Original strand, 27118335 - 27118493
Alignment:
32 cgagagcagaggaacggtggttgttacggtgtgtttcactgtgactttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgt 131  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||| |||||||||||    
27118335 cgagagcagaggaacggtggttgttacagtgtgtttcactgtgactttcataaattgatgctttttaattctaactctcgaaattttaattgccacatgt 27118434  T
132 catccatccgtaaaaagaaccaggtaaatagacaactgcataaatggagtagatatgga 190  Q
    ||||||||||||||||||||  |||||| ||||| |||||||||| |||||||| ||||    
27118435 catccatccgtaaaaagaactgggtaaacagacagctgcataaatagagtagatctgga 27118493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 76 - 190
Target Start/End: Complemental strand, 27117870 - 27117757
Alignment:
76 ctttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcataaa 175  Q
    ||||||| |||||||| | ||||||||||||||||| | ||||||||||||  ||||||||||| || || |||||| ||||||| || |||||||||||    
27117870 ctttcatcaattgatg-tgtttaatcctagctatcggatttttagttgccatgtgtcatccatcggtgaagagaaccgggtaaatggagaactgcataaa 27117772  T
176 tggagtagatatgga 190  Q
    | ||| |||| ||||    
27117771 ttgagcagatctgga 27117757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 24 - 185
Target Start/End: Original strand, 32239962 - 32240123
Alignment:
24 aactgatgcgagagcagaggaacggtggttgttacggtgtgtttcactgtgactttcataaattgatgctttttaatcctagctatcgaaattttagttg 123  Q
    ||||||||||||| |||||||||||| |||||||| ||||||||||  ||| |||||||||| ||||| |||||||||||||| |||  | |||||||||    
32239962 aactgatgcgagaacagaggaacggttgttgttacagtgtgtttcaacgtgtctttcataaaatgatgttttttaatcctagccatctgatttttagttg 32240061  T
124 ccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcataaatggagtagat 185  Q
    |||| ||||||||||| || || |||||| ||||||| |||| |||||||||||||| ||||    
32240062 ccacgtgtcatccatcagtgaagagaaccgggtaaatggacagctgcataaatggagcagat 32240123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 188
Target Start/End: Complemental strand, 32239546 - 32239435
Alignment:
76 ctttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcataaa 175  Q
    ||||||| |||||||| | |||||||||||| |||  | ||||||||||||| ||||||||||| || || |||||   |||||| |||| |||||||||    
32239546 ctttcatcaattgatg-tgtttaatcctagccatctgatttttagttgccacgtgtcatccatcagtgaagagaactgagtaaatggacagctgcataaa 32239448  T
176 tggagtagatatg 188  Q
    ||||| |||||||    
32239447 tggagcagatatg 32239435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 73 - 185
Target Start/End: Complemental strand, 23011062 - 23010951
Alignment:
73 tgactttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcat 172  Q
    |||||||||| |||||||| | |||||||||||| |||  | ||||||||||||| ||||||||||| || || |||||||||||||| |||| ||||||    
23011062 tgactttcatcaattgatg-tgtttaatcctagccatctgatttttagttgccacgtgtcatccatcagtgaagagaaccaggtaaatggacagctgcat 23010964  T
173 aaatggagtagat 185  Q
    |||||||| ||||    
23010963 aaatggagcagat 23010951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 76 - 185
Target Start/End: Original strand, 53371891 - 53371999
Alignment:
76 ctttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcataaa 175  Q
    ||||||| |||||||| | |||||||||||| |||  | ||||||||||||| ||||||||||| || || |||||| ||||||| |||| |||||||||    
53371891 ctttcatcaattgatg-tgtttaatcctagccatctgatttttagttgccacgtgtcatccatcagtgaagagaaccgggtaaatggacagctgcataaa 53371989  T
176 tggagtagat 185  Q
    ||||| ||||    
53371990 tggagcagat 53371999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 76 - 185
Target Start/End: Original strand, 3010 - 3118
Alignment:
76 ctttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcataaa 175  Q
    ||||||| |||||||| | |||||||||| | |||  | ||||||||||||| ||||||||||| || || |||| | ||||||| |||| |||||||||    
3010 ctttcatcaattgatg-tgtttaatcctaaccatctgatttttagttgccacgtgtcatccatcagtgaagagaatcgggtaaatggacagctgcataaa 3108  T
176 tggagtagat 185  Q
    ||||| ||||    
3109 tggagcagat 3118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 76 - 185
Target Start/End: Complemental strand, 7266720 - 7266612
Alignment:
76 ctttcataaattgatgctttttaatcctagctatcgaaattttagttgccacatgtcatccatccgtaaaaagaaccaggtaaatagacaactgcataaa 175  Q
    |||||||||||||||| |||||||||||||| || ||  ||||| ||||||  | |||| |||| || || |||||| ||||||| || |  ||||||||    
7266720 ctttcataaattgatg-tttttaatcctagccatggagtttttaattgccatgtatcattcatcggtgaagagaaccgggtaaatggatagatgcataaa 7266622  T
176 tggagtagat 185  Q
    ||||| ||||    
7266621 tggagcagat 7266612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University