View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8990_low_24 (Length: 246)
Name: NF8990_low_24
Description: NF8990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8990_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32552683 - 32552446
Alignment:
| Q |
1 |
caaattaaacatgtccaattttgcttcttcaactaaaccctacaaggtaattttatagaaaaggcaaatcataagttaaaacaaaacattatttttattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32552683 |
caaattaaacatgtccaattttgcttcttcaactaaaccctacaaggtaattttatagaaaaggcaaatcataagttaaaacaaaacattatttttattc |
32552584 |
T |
 |
| Q |
101 |
cggtatctagatcatccaataatatgatgatcaatagaaaacataaatactacattaacaaagatacaaattggcaataggataattgtaaaaagggaaa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32552583 |
cggtatctagatcatacaataatatgatgatcaatagaaaacataaatactacattaacaaatatacaaattggcaataggataattgtaaaaagggaaa |
32552484 |
T |
 |
| Q |
201 |
tgacatgactaaatgattctatccagtccacaggttct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32552483 |
tgacatgactaaatgattctatccagtccacaagttct |
32552446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 32546983 - 32546942
Alignment:
| Q |
1 |
caaattaaacatgtccaattttgcttcttcaactaaacccta |
42 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
32546983 |
caaattaaacaagtccaattttgcttcttcaaccaaacccta |
32546942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 32549366 - 32549322
Alignment:
| Q |
1 |
caaattaaacatgtccaattttgcttcttcaactaaaccctacaa |
45 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
32549366 |
caaattaaacaagtccactttttcttcttcaactaaaccctacaa |
32549322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University