View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8990_low_27 (Length: 237)
Name: NF8990_low_27
Description: NF8990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8990_low_27 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 11783961 - 11783754
Alignment:
| Q |
16 |
caagcatcacttagacagttctaaaccctagtttcagatattgcagttttgattctccatttctcactcatcgtatgagttcccttatttaaaatctagt |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11783961 |
caagcatcacttaaacagttctaaaccctagtttcagatattgcagttttgattctccatttctcactcatcgtatgagttcccttatttaaaatctagt |
11783862 |
T |
|
| Q |
116 |
tttttgatcccttactaggattttgcatctaaaaatggcgatgtaccaaattttttattgacaagctaaaaaattaacaagcataacatgattaaataaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11783861 |
tttttgatcccttactaggattttgcatctaaaaatggcgatgtaccaaattttttattgacaagctaaaaaattaacaagcataacatgattaaatcaa |
11783762 |
T |
|
| Q |
216 |
caacataa |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
11783761 |
caacataa |
11783754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 58
Target Start/End: Original strand, 121124 - 121152
Alignment:
| Q |
30 |
acagttctaaaccctagtttcagatattg |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
121124 |
acagttctaaaccctagtttcagatattg |
121152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University