View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8991_high_22 (Length: 346)
Name: NF8991_high_22
Description: NF8991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8991_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 257
Target Start/End: Complemental strand, 46744832 - 46744590
Alignment:
| Q |
15 |
agaggcatttggcactccaaagtgggtcattgaggtctactccatggcgttcaagctctgtggcaaacccaccatctatgattccatacccaccacactt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46744832 |
agaggcatttggcactccaaagtgggtcattgaggtcaattccatggcgttcaagctctgtggcaaacccaccatctatgattccatacccaccacactt |
46744733 |
T |
 |
| Q |
115 |
gttcagaaaatctttcatcatgtttgagctatgtgtcctaatgttttcttgtgttatgatcttgtatttgcttatttatagcatcaattctatttcgtag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
46744732 |
gttcagaaaatctttcatcatgtttgagctatgtggcctaatgttttcttgtgttatgatcttgtattagcttatttatagcattaattctatttcgtag |
46744633 |
T |
 |
| Q |
215 |
atttatgggattttgtgaacttaccatcatgaccctaacatgc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46744632 |
atttatgggattttgtgaacttaccatcatgaccctaacatgc |
46744590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 293 - 329
Target Start/End: Complemental strand, 46744557 - 46744521
Alignment:
| Q |
293 |
agtcaagttgatttcgatatcaagaaatgcaaatctc |
329 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
46744557 |
agtcaagttgatttccatatcaagaaatgcaagtctc |
46744521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 38139134 - 38139190
Alignment:
| Q |
16 |
gaggcatttggcactccaaagtgggtcattgaggtctactccatggcgttcaagctc |
72 |
Q |
| |
|
|||||||||||| |||||||| || ||||||||||| | ||||||||||||||||| |
|
|
| T |
38139134 |
gaggcatttggcgctccaaaggggatcattgaggtcggcgccatggcgttcaagctc |
38139190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University