View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8991_low_55 (Length: 323)
Name: NF8991_low_55
Description: NF8991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8991_low_55 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 14 - 323
Target Start/End: Complemental strand, 21872731 - 21872422
Alignment:
| Q |
14 |
attattctctagaagttctccaaaatggtatttccataatgatgtaaaatgggaacatcacagttcaacaattgcatttcacattcttgagttaaggcag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21872731 |
attattctctagaagttctccaaaatggtatttccagaatgatgtgaaatgggaacatcacagttcaacaattgcttttcacattcttgagttaaggcaa |
21872632 |
T |
 |
| Q |
114 |
agtgaaaatttaaggaaaaattaacgaattccccttgcatatgcctgcagacattcaagtgtacgcgaaatttcattgatgatgctaatggcatacctat |
213 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872631 |
agtgaaaatttaaggacaaattaacaaattccccttgcatatgcctgcagacattcaagtgtacgcgaaatttcattgatgatgctaatggcatacctat |
21872532 |
T |
 |
| Q |
214 |
cctacatgttggcagaggtatttgatgctcatttaatctgtctttcaatgattttccatcggttaaaatcccaaagaactaagacgctgtttggataaac |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872531 |
cctacatgttggcagaggtatttgatgctcatttaatctgtctttcaatgattttccatcggttaaaatcccaaagaactaagacgctgtttggataaac |
21872432 |
T |
 |
| Q |
314 |
aacttaatta |
323 |
Q |
| |
|
|||||||||| |
|
|
| T |
21872431 |
aacttaatta |
21872422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University