View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8991_low_67 (Length: 236)
Name: NF8991_low_67
Description: NF8991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8991_low_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 31201133 - 31201355
Alignment:
| Q |
1 |
acactctctttcaaatcatttgcagcattgcctctataatataagctcacttttctagctaaacgctttggtgtagggtcgtacactactttccttaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31201133 |
acactctctttcaaatcatttgcagcattgcctctataatataagctcacttttctagctaaacgctttggtgtagggtcgtacactactttccttaact |
31201232 |
T |
|
| Q |
101 |
tgctcaataaagtcgatttggaattttctaccgattgtggaactcgagtgtttgtttgctgtgttgatgttgaccttgaaggtgaatgctggaacatctc |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31201233 |
tgcttaataaagtcgatttggaattttctaccgattgtggaactcgagtgtttgtttgctgtgttgatgttgaccttgaaggtgaatgctggaaaatctc |
31201332 |
T |
|
| Q |
201 |
tctgattcttgtggggttgtagc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31201333 |
tctgattcttgtggggttgtagc |
31201355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 115 - 219
Target Start/End: Original strand, 13605376 - 13605478
Alignment:
| Q |
115 |
gatttggaattttctaccgattgtggaactcgagtgtttgtttgctgtgttgatgttgaccttgaaggtgaatgctggaacatctctctgattcttgtgg |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||| | | ||||| |||||||| |
|
|
| T |
13605376 |
gatttggaattttctaccaattgtggaacttgtgtgtttgtttgctgtgttgatgttgaccttgaagatgaatgctggaaaa--tttctgagtcttgtgg |
13605473 |
T |
|
| Q |
215 |
ggttg |
219 |
Q |
| |
|
||||| |
|
|
| T |
13605474 |
ggttg |
13605478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University