View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8991_low_72 (Length: 220)
Name: NF8991_low_72
Description: NF8991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8991_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 30399690 - 30399893
Alignment:
| Q |
1 |
gttgtaccaaaagaaaagctaacaatttaataaaaaatctcaaaattactatgcaggcaagaaaggaggcaaatagattagatttgtatgtacaaaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30399690 |
gttgtaccaaaagaaaagctaacaatttaataaaaaatctcaaaattactatgcaggcaagaaaggaggcaaatagattagatttgtatgtacaaaactt |
30399789 |
T |
 |
| Q |
101 |
gtcatcctgggttaataaagagaaggatatttccaagaaaacaagactaaacacatccccaagccaagtattctaagaatgacgatatttcacatgtcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30399790 |
gtcatcctgggttaataaagagaaggatatttccaagaaaacaagactaaacatatccccaagctaagtattctaagaatgacgatatttcacatgtcaa |
30399889 |
T |
 |
| Q |
201 |
tatt |
204 |
Q |
| |
|
|||| |
|
|
| T |
30399890 |
tatt |
30399893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University