View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8992_low_15 (Length: 304)
Name: NF8992_low_15
Description: NF8992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8992_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 288
Target Start/End: Complemental strand, 50229440 - 50229167
Alignment:
| Q |
15 |
gagatgcataggtgagggtggggagtggatgtgcagaggtggagaaggcgtctttttacttaggaggcggcnnnnnnnacaggttaacatggttgattga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50229440 |
gagatgcataggtgagggtggggagtggatgtgcagaggtggagaaggcgtctttttacttaggaggcggctttttttacaggttaacatggttgattga |
50229341 |
T |
 |
| Q |
115 |
tgactttggttacttaatctgtctaacggatattcagtcaaagatgcttatcaaactcataagcatgtgatcaacccaacttagatannnnnnnctcatt |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50229340 |
tgactttggttacttagtctgtctaacggatattcagtcaaagatgcttatcaaactcataagcatgtgatcaacccaacttagatatttttttctcatt |
50229241 |
T |
 |
| Q |
215 |
tggtttggaacaaaactaaactatgaagatatcattatatatggaggctcttgaacaaaaggattcctactaag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50229240 |
tggtttggaacaaaactaaactatgaagatatcattatatatggaggctcttgaacaaaaggattcctactaag |
50229167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University