View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8992_low_18 (Length: 285)
Name: NF8992_low_18
Description: NF8992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8992_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 12488501 - 12488249
Alignment:
| Q |
17 |
atgagattgaaaagatgatgaattcttttttgtcgaggcattccgattcacaaaataaaggcatcattggttc------------ttatgcatgggataa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12488501 |
atgagattgaaaagatgatgaattcttttttgtcgaggcattccgattcacaaaataaaggcatcattggttccatcattggttcttatgcatgggataa |
12488402 |
T |
|
| Q |
105 |
attttttatgcataaaactgatttgaggcaaaattttatcacgtttcaatcttgctatggttgggaaacacggttggcacttggcatatcatgtcttata |
204 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12488401 |
attttttatgcataaaactgatt-gaggcaaaaatttatcacgtttcaatcttgctatggttgggaaacacggttggcacttggcatatcatgtcttata |
12488303 |
T |
|
| Q |
205 |
tcctaattttctgtcgatgggactatgggagcattggaaattgaagtatttcacttttaata |
266 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
12488302 |
tcctaattttctgt--------caatgggagcattggaaatggaagtattccacttttaata |
12488249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University