View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_1D_high_5 (Length: 361)
Name: NF8995_1D_high_5
Description: NF8995_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_1D_high_5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0003 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 19 - 361
Target Start/End: Original strand, 24493494 - 24493836
Alignment:
| Q |
19 |
catcacaaaccacaccaccattggagcgcatatcaacgtcatcctctgaatttttgagacccatcacacgatccatgcataacatacacaagccaaacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24493494 |
catcacaaaccacaccaccattggagcgcatatcaacgtcatcctctgaatttttgagacccatcacacgatccatgcataacatacacaagccaaacaa |
24493593 |
T |
|
| Q |
119 |
aaagtatttgttggtcacaaaacatcctttaccatcatcgcttgaacctacatgtgtatcacaagcaatggcttcttctgaatggcgtgccgccatggca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24493594 |
aaagtatttgttggtcacaaaacatcctttaccatcatcgcttgaacctacatgtgtatcacaagcaatggcttcttctgaatggtgtgccgccatggca |
24493693 |
T |
|
| Q |
219 |
tcagaatttaatgcattgatgcaacaggggacttgggatctagttccgaaaaacacagcgtctaatctcattggatgtaagtgggtgtttcgggtgaaac |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24493694 |
tcagaatttaatgcattgatgcaacaggggacttgggatctagttcctaaaaacacagcgtctaatctcattggatgtaagtgggtgtttcgggtgaaac |
24493793 |
T |
|
| Q |
319 |
gtcggccagacggctccattgatagatacaaggcacgtctagt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24493794 |
gtcggccagacggctccattgatagatacaaggcacgtctagt |
24493836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 150 - 361
Target Start/End: Original strand, 92975 - 93186
Alignment:
| Q |
150 |
ccatcatcgcttgaacctacatgtgtatcacaagcaatggcttcttctgaatggcgtgccgccatggcatcagaatttaatgcattgatgcaacagggga |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92975 |
ccatcatcgcttgaacctacatgtgtatcacaagcaatggcttcttctgaatggagtgccgccatggcatcagaatttaatgcattgatgcaacagggga |
93074 |
T |
|
| Q |
250 |
cttgggatctagttccgaaaaacacagcgtctaatctcattggatgtaagtgggtgtttcgggtgaaacgtcggccagacggctccattgatagatacaa |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
93075 |
cttgggatctagttccaaaaaacacagcgtctaatctcattggatgtaagtgggtgtttcgggtgaaacgtcggccagacggctccattgacagatacaa |
93174 |
T |
|
| Q |
350 |
ggcacgtctagt |
361 |
Q |
| |
|
|||||||||||| |
|
|
| T |
93175 |
ggcacgtctagt |
93186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 92859 - 92951
Alignment:
| Q |
19 |
catcacaaaccacaccaccattggagcgcatatcaacgtcatcctctgaatttttgagacccatcacacgatccatgcataacatacacaagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92859 |
catcacaaaccacaccaccattggagcgcatatcaacgtcatcctctgaatatttgagacccatcacacgatccatgcataacatacacaagc |
92951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 178 - 209
Target Start/End: Original strand, 92945 - 92976
Alignment:
| Q |
178 |
cacaagcaatggcttcttctgaatggcgtgcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
92945 |
cacaagcaatggcttcttctgaatggcgtgcc |
92976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University