View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_1D_low_11 (Length: 332)
Name: NF8995_1D_low_11
Description: NF8995_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_1D_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 5 - 304
Target Start/End: Complemental strand, 23332894 - 23332595
Alignment:
| Q |
5 |
atgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggatggttgggctgagct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23332894 |
atgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggatggttgggctgagct |
23332795 |
T |
|
| Q |
105 |
gaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332794 |
gaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaa |
23332695 |
T |
|
| Q |
205 |
atcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacatat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332694 |
atcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 10 - 77
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
| Q |
10 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
77 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
| T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University