View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_1D_low_18 (Length: 278)
Name: NF8995_1D_low_18
Description: NF8995_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_1D_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 23333583 - 23333847
Alignment:
| Q |
1 |
acatataaaaaatcacttacagttgcagtctcaagctctgcataatatgtattcagcaatcgcatctcttgaagggaaagctcatcagcaacacgaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333583 |
acatataaaaaatcacttacagttgcggtctcaagctctgcataatatgtattcagcaatcgcatctcttgaagggaaagctcatcagcaacacgaacaa |
23333682 |
T |
|
| Q |
101 |
cagttcctgaggtaacgacaatgtgtacatttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattacataaaacaaacttatcaacctc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333683 |
cagttcctgaggcaacgacaatgtgtacatttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattacataaaacaaacttatcaacctc |
23333782 |
T |
|
| Q |
201 |
tttgggggagtactgcttcagctgcattctggcacacaattttatcggtcaacttcgtgatgtcc |
265 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
23333783 |
ttggggggagtactgcttcagctgcattccggcacacaattttatcggtcaacttcgttatgtcc |
23333847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University