View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_1D_low_19 (Length: 272)
Name: NF8995_1D_low_19
Description: NF8995_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_1D_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 31 - 267
Target Start/End: Original strand, 22684112 - 22684350
Alignment:
| Q |
31 |
cagaacctgtggtaaatttaaacaaataaagcattaattaaacactgcaaattcattctctttgtcattataacttgcttcctgcgatagtgagtaacat |
130 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22684112 |
cagaacctgtggtaaatttgaacaaataaagcattaattaaacactgcaaattcattctctttgtcattataacttgcttccagcgatagtgagtaacat |
22684211 |
T |
 |
| Q |
131 |
attggcaagtaagacaccaatatgctacaaaacttgagcaaatgtggccgcaattgcggtcacaattggcgtttaggagatctctaaaacctt--tattg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22684212 |
attggcaagtaagacaccaatatgctacaaaacttgagcaaatgtggctgcaattgcggtcacaattggcgtttaggagatctctaaaacctttatattg |
22684311 |
T |
 |
| Q |
229 |
cagtcgcaattacagttgtaggctatgatgtgtttctca |
267 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22684312 |
cagccgcaattacagttgtaggctatgatgtgtttctca |
22684350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 158 - 267
Target Start/End: Original strand, 22695722 - 22695833
Alignment:
| Q |
158 |
caaaacttgagcaaatgtggccgcaattgcggtcacaattggcgtttaggagatctctaaaacctt--tattgcagtcgcaattacagttgtaggctatg |
255 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||| || ||| ||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
22695722 |
caaaactttagcaaatgtggctgcaattgcggtcacaactgccgtagaggagatctctaaaacctttatatcgcagccgcaattacagttgtaggctatg |
22695821 |
T |
 |
| Q |
256 |
atgtgtttctca |
267 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22695822 |
atgtgtttctca |
22695833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 22695522 - 22695596
Alignment:
| Q |
31 |
cagaacctgtggtaaatttaaacaaataaagcattaattaaacactgcaaattc-attctctttgtcattataac |
104 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||| |||| | ||| || ||| |||||||||||||||| |
|
|
| T |
22695522 |
cagaacctgcagtaaatttgaacaaataaagcatcaattacacaccgaaaaatctattgtctttgtcattataac |
22695596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University