View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_1D_low_22 (Length: 246)
Name: NF8995_1D_low_22
Description: NF8995_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_1D_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 52583180 - 52582956
Alignment:
| Q |
1 |
taatagacagactagaatgtctctccaacaacttggagtcattcaaaaccaacgacaagtttggagacctattagagggttacctgaaacatctgtagcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583180 |
taatagacagactagaatgtctctccaacaacttggagtcattcaaaaccaacgacaagtttggagacctattagagggttacctgaaacatctgtagca |
52583081 |
T |
|
| Q |
101 |
attcttcgtgcttggctctttgagcactttcttcatccgtaagcttatatcaaaattctgtttttgtttttatgttatgtcattttcttgtcttattaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583080 |
attcttcgtgcttggctctttgagcactttcttcatccgtaagcttatatcaaaattctgtttttgtttttatgttatgtcattttcttgtcttattaat |
52582981 |
T |
|
| Q |
201 |
gaaatgctaatttgatgtctgattt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52582980 |
gaaatgctaatttgatgtctgattt |
52582956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 123
Target Start/End: Original strand, 43242935 - 43242984
Alignment:
| Q |
74 |
agagggttacctgaaacatctgtagcgattcttcgtgcttggctctttga |
123 |
Q |
| |
|
||||| |||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
43242935 |
agaggattacctgaaagatctgtatctgttcttcgtgcttggctctttga |
43242984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University