View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_high_1 (Length: 1036)
Name: NF8995_high_1
Description: NF8995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_high_1 |
 |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0576 (1 HSPs) |
 |  |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
| [»] scaffold0623 (2 HSPs) |
 |  |  |
|
| [»] scaffold0459 (2 HSPs) |
 |  |  |
|
| [»] scaffold0366 (3 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (2 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0240 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (2 HSPs) |
 |  |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
| [»] scaffold0717 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0438 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 323; Significance: 0; HSPs: 54)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 356
Target Start/End: Original strand, 5373078 - 5373432
Alignment:
| Q |
1 |
gttgtgctgttggataaccttatcttgcttatattatagctatttaaaaaatttcaggaatgagctttttcttgaagacttcttttgagaacaaaatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373078 |
gttgtgctgttggataaccttatcttgcttatattatagctatttaaaaaatttcaggaatgagctttttcttgaagacttcttttgagaacaaaatgag |
5373177 |
T |
 |
| Q |
101 |
tgaattgtaggtacaaaatgcatatataaatagtatttgtcttagcttgtccttgttgtttctcctttacctggttaaataattgaaagagtcatataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5373178 |
tgaattgtaggtacaaaatgcatatataaatagtatttgtcttagcttgtccttgttgtttctcctttacctggttaaataattgaaagagtcatatagt |
5373277 |
T |
 |
| Q |
201 |
catcatttcacacgcccaaccatagttctcaaaaagcaaaagaatcccccctccnnnnnnncttcttctctatgattgagtgcagtgtaccactaaattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373278 |
catcatttcacacgcccaaccatagttctcaaaaagcaaaagaatcccccctccttttttt-ttcttctctatgattgagtgcagtgtaccactaaattt |
5373376 |
T |
 |
| Q |
301 |
tcttaattcaaaagaatagtatacggatgagataacctatttggggttggcctagt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373377 |
tcttaattcaaaagaatagtatacggatgagataacctatttggggttggcctagt |
5373432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 162; E-Value: 6e-86
Query Start/End: Original strand, 767 - 928
Target Start/End: Original strand, 5373429 - 5373590
Alignment:
| Q |
767 |
tagtcgttcaaacttctcttaacaataggtccacaatatgaaatcagccactttaattctgccggttagatattaaggactacatgacaaattttcatca |
866 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373429 |
tagtcgttcaaacttctcttaacaataggtccacaatatgaaatcagccactttaattctgccggttagatattaaggactacatgacaaattttcatca |
5373528 |
T |
 |
| Q |
867 |
aaatggagagtttcatatattttggagattaattatttgaaatttgttttggatcctagtac |
928 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373529 |
aaatggagagtttcatatattttggagattaattatttgaaatttgttttggatcctagtac |
5373590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 8077640 - 8077691
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8077640 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
8077691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 24674386 - 24674437
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24674386 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
24674437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 4621440 - 4621390
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4621440 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
4621390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 7197449 - 7197399
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7197449 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
7197399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 34778336 - 34778386
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34778336 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
34778386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 27455070 - 27455019
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27455070 |
taacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
27455019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 15059605 - 15059555
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15059605 |
aacccatttggggttggcctagtggttggcttggaatcttggagtttgctc |
15059555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 32729539 - 32729589
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32729539 |
aacccatttggggttggcctagtggttggcttgggatcttcgagtttgctc |
32729589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 46607804 - 46607854
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46607804 |
aacccatttggggttggcctagtggttgacttgggatcttggagtttgctc |
46607854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 47091684 - 47091734
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47091684 |
aacccatttggggttggcctagtggttggcttgagatcttggagtttgctc |
47091734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 334 - 383
Target Start/End: Complemental strand, 29057540 - 29057491
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29057540 |
aacccatttggggttggcctagtggttggtttgggatcttggagtttgct |
29057491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 46113600 - 46113555
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46113600 |
atttggggttggcctagtggttggtttgggatcttggagtttgctc |
46113555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 334 - 385
Target Start/End: Original strand, 168195 - 168246
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
168195 |
aacccatttggagttggcctagtggttggcttgggatcttagagtttgctct |
168246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 7766931 - 7766880
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7766931 |
taacccattcggggttggcctagtggttagcttgggatcttggagtttgctc |
7766880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 334 - 381
Target Start/End: Complemental strand, 14258630 - 14258583
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258630 |
aacccatttgggcttggcctagtggttggcttgggatcttggagtttg |
14258583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 25496692 - 25496641
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
25496692 |
taacctatttggcgttggcctagtgattggcttgggatcttggagattgctc |
25496641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 333 - 383
Target Start/End: Original strand, 18646846 - 18646896
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| ||||||||| |
|
|
| T |
18646846 |
taacctatttggggttgacctagtggttggcttgtgatctttgagtttgct |
18646896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 2272343 - 2272388
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
2272343 |
atttggggttggcctagtggttgacttgggatcttagagtttgctc |
2272388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 24122022 - 24122067
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
24122022 |
atttggggttggcttagtggttggcttgggatcttggggtttgctc |
24122067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 52135129 - 52135174
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
52135129 |
atttggggttggtctagtggttgacttgggatcttggagtttgctc |
52135174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 338 - 378
Target Start/End: Complemental strand, 1095194 - 1095154
Alignment:
| Q |
338 |
tatttggggttggcctagtggttggcttgggatcttggagt |
378 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1095194 |
tatttggggttggtctagtggttggcttgggatcttggagt |
1095154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 344 - 384
Target Start/End: Original strand, 6776148 - 6776188
Alignment:
| Q |
344 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6776148 |
gggttggcctagtggttggtttgggatcttggagtttgctc |
6776188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 1138572 - 1138623
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1138572 |
taacccatttggggttgacctagtggttggcttgagatcttggagtgtgctc |
1138623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 339 - 378
Target Start/End: Original strand, 1486419 - 1486458
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagt |
378 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1486419 |
atttggggttgacctagtggttggcttgggatcttggagt |
1486458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 334 - 385
Target Start/End: Complemental strand, 23232468 - 23232417
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
23232468 |
aacccatttgggattggcctagtggttgacttgggatcttgaagtttgctct |
23232417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 339 - 385
Target Start/End: Original strand, 1818733 - 1818779
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
||||||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
1818733 |
atttggggttggcctggtagttggcttaggatcttggagtttgctct |
1818779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 20487393 - 20487343
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
20487393 |
aacccatttggggttggtttagtggttggctcgggatcttggagtttgctc |
20487343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 30677170 - 30677220
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
30677170 |
aacccatttggggttgacctagtggttggtttgggatctaggagtttgctc |
30677220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 32729653 - 32729741
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||| |||||||||||||||| | ||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
32729653 |
ttgctctggctttaaatggggtccccgcaagtgggcggtgggattgatccccttggattagtcggtctttggatcggataccgagtttt |
32729741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 9926211 - 9926146
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||| |||||||||||||||||| |||||||||||| || ||||||||||||| |||| |
|
|
| T |
9926211 |
cccgcaactgggcggtgggattgatccctttagattagtcggtccttcgatcggataccgagtttt |
9926146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 24216977 - 24217022
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24216977 |
atttggggttgacctagtggttgacttgggatcttggagtgtgctc |
24217022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 27159217 - 27159282
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| | ||| ||||||||| ||| |||| |
|
|
| T |
27159217 |
cccgcaagtggacggtgggattggtcccctcagattagtcgatctttggatcggatatcgagtttt |
27159282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 45331686 - 45331621
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||| || ||| |||||||||||| |||| |
|
|
| T |
45331686 |
cccgcaagtggacggtgggattaatcccctcagattaatcgattcttgaatcggataccgagtttt |
45331621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 1379029 - 1379089
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccga |
458 |
Q |
| |
|
||||||||||||||||| ||||| |||| |||||||||||| || || ||||||||||||| |
|
|
| T |
1379029 |
cccgcaagtggacggtgagattggtcccctcagattagtcgattcttagatcggataccga |
1379089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 333 - 373
Target Start/End: Original strand, 2537697 - 2537737
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatctt |
373 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
2537697 |
taacccatttggggttggcctagtggttggattgggatctt |
2537737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 345 - 384
Target Start/End: Original strand, 1378903 - 1378942
Alignment:
| Q |
345 |
ggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
1378903 |
ggttggcttagtggttgacttgggatcttggagtttgctc |
1378942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 350 - 381
Target Start/End: Original strand, 7578419 - 7578450
Alignment:
| Q |
350 |
gcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7578419 |
gcctagtggttggcttgggatcttggagtttg |
7578450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 7946837 - 7946888
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||| | |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
7946837 |
taacccatttggggtcgacctagtggttggcttgagatcttgaagtttgctc |
7946888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 399 - 442
Target Start/End: Original strand, 30677308 - 30677351
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt |
442 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||| |
|
|
| T |
30677308 |
cccgcaagtgggcggtgggattggtcccctcagattagtcggtt |
30677351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 40802271 - 40802220
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||| | |||||||||||| ||| ||||||||||||| |
|
|
| T |
40802271 |
taacccatttggggttggctttgtggttggcttgagatattggagtttgctc |
40802220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 399 - 441
Target Start/End: Original strand, 46607942 - 46607984
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt |
441 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
46607942 |
cccgcaagtgggcggtgggattgatcccctcggattagtcggt |
46607984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 402 - 455
Target Start/End: Original strand, 52135261 - 52135315
Alignment:
| Q |
402 |
gcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggatac |
455 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||||||||||| || |||||||||| |
|
|
| T |
52135261 |
gcaagtggacggtgggattggtcccctcatattagtcggttcttggatcggatac |
52135315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 380
Target Start/End: Original strand, 1378744 - 1378785
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||||| |
|
|
| T |
1378744 |
atttggggttggtctagtggttgacttggaatcttggagttt |
1378785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 1486552 - 1486617
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||| | |||| || ||||||||||| || ||||||||||||| |||| |
|
|
| T |
1486552 |
cccgcaagtggacggtgggatcggtcccctccgattagtcggtccttggatcggataccgagtttt |
1486617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 4621302 - 4621237
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
4621302 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
4621237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 24122155 - 24122220
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
24122155 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
24122220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 24674525 - 24674590
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||| || || |||||||||||||||||| |
|
|
| T |
24674525 |
cccgcaagtgggcggtgggattggtcccctcgtattagtcgattcttggatcggataccgaatttt |
24674590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 402 - 462
Target Start/End: Original strand, 32930884 - 32930945
Alignment:
| Q |
402 |
gcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaattt |
462 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| || || ||| ||||||||||||| |
|
|
| T |
32930884 |
gcaagtggatggtgggattgatcccctcagattaatcgattcttagattggataccgaattt |
32930945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 35138120 - 35138185
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||||| || || ||||||||||| || ||||||||||||| |||| |
|
|
| T |
35138120 |
cccgcaagtgggcggtgggattgattccctcggattagtcggtccttggatcggataccgagtttt |
35138185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 36155953 - 36155888
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||| |||| ||||||||||| |||||||| |||||||| || || ||||||||||||| |||| |
|
|
| T |
36155953 |
cccgcaggtgggcggtgggattggtcccttcaaattagtcgattcttggatcggataccgagtttt |
36155888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 355 - 384
Target Start/End: Complemental strand, 37351643 - 37351614
Alignment:
| Q |
355 |
gtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37351643 |
gtggttggcttgggatcttggagtttgctc |
37351614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 48699891 - 48699956
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||||||| || || ||||||||| ||| |||| |
|
|
| T |
48699891 |
cccgcaagtgggcggtgggattgttcccttcggattagtcgattcttggatcggatatcgagtttt |
48699956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 3e-20; HSPs: 46)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 28193471 - 28193522
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28193471 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
28193522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 4718642 - 4718693
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4718642 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
4718693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 2618184 - 2618234
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618184 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
2618234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 3734826 - 3734776
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3734826 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
3734776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 18532105 - 18532155
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18532105 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
18532155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 34237858 - 34237808
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34237858 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
34237808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 19471612 - 19471657
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19471612 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
19471657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 19542536 - 19542581
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19542536 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
19542581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 19590160 - 19590115
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19590160 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
19590115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 332 - 384
Target Start/End: Original strand, 20305904 - 20305956
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20305904 |
ataacccatttggggttggcctagtggttggcttgggatcttagagtttgctc |
20305956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 332 - 384
Target Start/End: Original strand, 21092537 - 21092589
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21092537 |
ataacccatttggggttggcctagtggttggcttgggatcttagagtttgctc |
21092589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 332 - 384
Target Start/End: Complemental strand, 42643323 - 42643271
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42643323 |
ataacccatttggggttggcctagtggttgacttgggatcttggagtttgctc |
42643271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 375 - 463
Target Start/End: Original strand, 25248457 - 25248547
Alignment:
| Q |
375 |
gagtttgctctagctttaaataggccc--gcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| ||||||||||| |||| || ||||||||| |||||||||||||||||| |||| |
|
|
| T |
25248457 |
gagtttgctctggctttaaacgggccctcgcaagtgggcggtgggattggtcccctcggattagtcgatttttgatcggataccgagtttt |
25248547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 39349254 - 39349304
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39349254 |
aacccatttggggttggcccagtggttggcttgggatcttggagtttgctc |
39349304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 27746533 - 27746488
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27746533 |
atttggggttggcctagtggttggtttgggatcttggagtttgctc |
27746488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 380
Target Start/End: Original strand, 42328008 - 42328049
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42328008 |
atttggggttggcctagtggttggcttgggatcttggagttt |
42328049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 328 - 384
Target Start/End: Original strand, 24018374 - 24018430
Alignment:
| Q |
328 |
tgagataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24018374 |
tgagaaaacctatttggggttgatctagtggttgacttgggatcttggagtttgctc |
24018430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 7558146 - 7558096
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
7558146 |
aacccatttggggttggcctagtagttagcttgggatcttggagtttgctc |
7558096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 26169051 - 26169001
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26169051 |
aacccatttagggttggcctagtggtttgcttgggatcttggagtttgctc |
26169001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 264597 - 264552
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
264597 |
atttggcgttggcctagtggttggcttgggatcttcgagtttgctc |
264552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 651324 - 651369
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
651324 |
atttggcgttggcctagtggttggcttgggatcttcgagtttgctc |
651369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 837059 - 837104
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
837059 |
atttggcgttggcctagtggttggcttgggatcttcgagtttgctc |
837104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 8042657 - 8042702
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
8042657 |
atttggggttgacctagtgcttggcttgggatcttggagtttgctc |
8042702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 2166810 - 2166897
Alignment:
| Q |
379 |
ttgctctagctttaaatagg--cccgcaagtggacggtgggattgatcccttcagattagtcg-gtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||||| | ||||||||||| ||||||||||| |||| |||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
2166810 |
ttgctctggctttaaataagaccccgcaagtgggcggtgggattggtcccctcagattagtcgattttttgattggataccgagtttt |
2166897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 15259604 - 15259559
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
15259604 |
atttggggttggtctagtggttggtttgggatcttggattttgctc |
15259559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 347 - 384
Target Start/End: Original strand, 21603241 - 21603278
Alignment:
| Q |
347 |
ttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21603241 |
ttggcctagtggttggcttgggatcttagagtttgctc |
21603278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 34639404 - 34639359
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
34639404 |
atttggggttagtctagtggttggcttgggatcttggagtgtgctc |
34639359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 34694774 - 34694729
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
34694774 |
atttggggttggtctagtggttgacttgtgatcttggagtttgctc |
34694729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 383
Target Start/End: Original strand, 41070767 - 41070808
Alignment:
| Q |
342 |
tggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
41070767 |
tggggttggcctagtggttgacttgggatcttggagtgtgct |
41070808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 399 - 458
Target Start/End: Complemental strand, 7558016 - 7557956
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccga |
458 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||||| |||||| |||||||||||| |
|
|
| T |
7558016 |
cccgcaagtggacggtgggattggtcccctcgaattagtcgatttttgcatcggataccga |
7557956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 339 - 383
Target Start/End: Complemental strand, 8387642 - 8387598
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
8387642 |
atttggggttggcctagtggttgtcttgagatcttagagtttgct |
8387598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 374 - 463
Target Start/End: Complemental strand, 36848842 - 36848750
Alignment:
| Q |
374 |
ggagtttgctctagctttaaat-aggc-ccgcaagtggacggtgggattgatcccttcagattagtcggttttt-gatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||| |||| || ||||||| |||||||||| |||| ||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
36848842 |
ggagtttgctcgggctttaaatgaggcaccacaagtgggcggtgggattagtcccctcaaattagtcggtttttggatcggataccaaatttt |
36848750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 342 - 381
Target Start/End: Original strand, 28088292 - 28088331
Alignment:
| Q |
342 |
tggggttggcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
28088292 |
tggggttggcttagtggttgacttgggatcttggagtttg |
28088331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 334 - 381
Target Start/End: Original strand, 32879277 - 32879324
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
32879277 |
aacccatttggggttggtctagtggttgacttgggatcttcgagtttg |
32879324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 380
Target Start/End: Complemental strand, 775984 - 775938
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| |||||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
775984 |
aaccaatttggggttggtccaatggttggcttgggatcttggagttt |
775938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 380
Target Start/End: Complemental strand, 781638 - 781592
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| |||||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
781638 |
aaccaatttggggttggtccaatggttggcttgggatcttggagttt |
781592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 399 - 456
Target Start/End: Original strand, 39349392 - 39349450
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggatacc |
456 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| || || ||||||||||| |
|
|
| T |
39349392 |
cccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggatacc |
39349450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 2639476 - 2639411
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
2639476 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
2639411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 4718781 - 4718846
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
4718781 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
4718846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 8765591 - 8765526
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
8765591 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
8765526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 346 - 383
Target Start/End: Complemental strand, 11715010 - 11714973
Alignment:
| Q |
346 |
gttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
11715010 |
gttggcctagtggttggtttgagatcttggagtttgct |
11714973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 18128649 - 18128714
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||||||||||||| || ||||| ||||||| |||| |
|
|
| T |
18128649 |
cccgcaagtgggcggtgggattggtcctctcagattagtcggttcttggatcgaataccgagtttt |
18128714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 21603366 - 21603431
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
21603366 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
21603431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 21667553 - 21667598
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
21667553 |
atttgaggttggtctagtggttggcttggaatcttggaggttgctc |
21667598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 28964036 - 28964081
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||| |||||||||| |
|
|
| T |
28964036 |
atttggggttggtctagtggttggtttgagatcttagagtttgctc |
28964081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 36848947 - 36848902
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||| ||||||||| |||||| | ||||||||||||| |
|
|
| T |
36848947 |
atttggggttggcatagtggttgacttgggtttttggagtttgctc |
36848902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 3e-20; HSPs: 66)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 27312149 - 27312200
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27312149 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
27312200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 18044104 - 18044155
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18044104 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
18044155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 2344297 - 2344347
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2344297 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
2344347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 2751269 - 2751319
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2751269 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
2751319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 7176065 - 7176015
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7176065 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
7176015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 7275275 - 7275325
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7275275 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
7275325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 21218036 - 21217986
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21218036 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
21217986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 23854394 - 23854444
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23854394 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
23854444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 40543113 - 40543063
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40543113 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
40543063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 2103058 - 2103103
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2103058 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
2103103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 13332621 - 13332576
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13332621 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
13332576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 22119891 - 22119936
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22119891 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
22119936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 10091185 - 10091236
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10091185 |
taacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
10091236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 27009356 - 27009407
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27009356 |
taacccatttggggttggcctagtggttggcttcggatcttggagtttgctc |
27009407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 17212051 - 17212101
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17212051 |
aacccatttggggttggcttagtggttggcttgggatcttggagtttgctc |
17212101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 31197589 - 31197639
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31197589 |
aacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
31197639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 31713098 - 31713048
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31713098 |
aacccatttggggttggcctagtggttggtttgggatcttggagtttgctc |
31713048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 7800030 - 7799985
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7800030 |
atttggggttgacctagtggttggcttgggatcttggagtttgctc |
7799985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 334 - 383
Target Start/End: Original strand, 25333417 - 25333466
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25333417 |
aacccatttggggttggcttagtggttggcttgggatcttggagtttgct |
25333466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 28089819 - 28089864
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28089819 |
atttggggttggcctagtggttggcttgagatcttggagtttgctc |
28089864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 345 - 384
Target Start/End: Complemental strand, 42913705 - 42913666
Alignment:
| Q |
345 |
ggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42913705 |
ggttggcctagtggttggcttgggatcttggagtttgctc |
42913666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 11997847 - 11997897
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11997847 |
aacccatttgtggttgggctagtggttggcttgggatcttggagtttgctc |
11997897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 380
Target Start/End: Original strand, 21370595 - 21370641
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21370595 |
aacccatttggggttggcctagtggttggtttgggatcttggagttt |
21370641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 32849589 - 32849639
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
32849589 |
aacccatttggggttagcctagtggttgacttgggatcttggagtttgctc |
32849639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 577682 - 577727
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
577682 |
atttggggttggcctagtggtttgcttgggatcttagagtttgctc |
577727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 8435893 - 8435848
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8435893 |
atttggggttggtctagtggttgacttgggatcttggagtttgctc |
8435848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 10091301 - 10091388
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||| |||||||||||||||| || ||||||||| || |||||| |||||||| |||| |
|
|
| T |
10091301 |
ttgctctggctttaaatggggtccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttgatccgataccgagtttt |
10091388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 12211733 - 12211688
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
12211733 |
atttggggttggcctagtggttggcttaggatcttggagtgtgctc |
12211688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 19421234 - 19421279
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
19421234 |
atttggggttgacttagtggttggcttgggatcttggagtttgctc |
19421279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 21835154 - 21835199
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21835154 |
atttagggttgacctagtggttggcttgggatcttggagtttgctc |
21835199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 28003839 - 28003884
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28003839 |
atttggggttgatctagtggttggcttgggatcttggagtttgctc |
28003884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 334 - 383
Target Start/End: Original strand, 28646967 - 28647016
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
28646967 |
aacctatttggggttggcctagtgattgacttgggatcttggagtgtgct |
28647016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 404 - 463
Target Start/End: Complemental strand, 674496 - 674436
Alignment:
| Q |
404 |
aagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| || ||||||| |||||||||| |
|
|
| T |
674496 |
aagtggacggtgggattgatcccctcagattagtcggtccttagatcggacaccgaatttt |
674436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 339 - 383
Target Start/End: Complemental strand, 23012706 - 23012662
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23012706 |
atttagggttggcccagtggttggcttgggatcttggagtttgct |
23012662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 17197154 - 17197103
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
17197154 |
taacccatttggggtcggcctagtggttggtttgcgatcttggagtttgctc |
17197103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 39145856 - 39145805
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
39145856 |
taacccatttgaggttgacctagtggttgacttgggatcttggagtttgctc |
39145805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 350 - 384
Target Start/End: Original strand, 22299863 - 22299897
Alignment:
| Q |
350 |
gcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22299863 |
gcctagtggttggcttgggatcttggagtttgctc |
22299897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 654770 - 654705
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||||| || ||||||||||||| |||| |
|
|
| T |
654770 |
cccgcaagtgggcggtgggattggtcccctcggattagtcggttcttggatcggataccgagtttt |
654705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 3851893 - 3851958
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
3851893 |
cccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagtttt |
3851958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 21574301 - 21574256
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||| ||||| |
|
|
| T |
21574301 |
atttggggttggcctagtggttggtttgggattttggagtgtgctc |
21574256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 27312288 - 27312353
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||| || || ||||||||||||| |||| |
|
|
| T |
27312288 |
cccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagtttt |
27312353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 42814867 - 42814912
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
42814867 |
atttggagttggcttagtggttgacttgggatcttggagtttgctc |
42814912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 341 - 385
Target Start/End: Original strand, 47380903 - 47380947
Alignment:
| Q |
341 |
ttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
47380903 |
ttggggttggcctagtggttggcttgagattttgtagtttgctct |
47380947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 334 - 385
Target Start/End: Original strand, 22638290 - 22638341
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||| |||||| ||||||||||| |
|
|
| T |
22638290 |
aacccatttggggttggtctagtggttgacttgagatcttagagtttgctct |
22638341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 353 - 384
Target Start/End: Original strand, 22703503 - 22703534
Alignment:
| Q |
353 |
tagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22703503 |
tagtggttggcttgggatcttggagtttgctc |
22703534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 334 - 385
Target Start/End: Complemental strand, 33137998 - 33137948
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
33137998 |
aacccatttggggttggcctagtg-ttggcttgggaatttggagtttgctct |
33137948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 339 - 381
Target Start/End: Original strand, 1469115 - 1469157
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
1469115 |
atttggggttggcctagtggttgacttgaaatcttggagtttg |
1469157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 3951189 - 3951143
Alignment:
| Q |
339 |
atttggggttggcctagtggttggctt-gggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
3951189 |
atttggggttggtctagtggttggcttggggatcttggagtgtgctc |
3951143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 7275390 - 7275478
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
7275390 |
ttgctctggctttaaacagggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
7275478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 399 - 456
Target Start/End: Original strand, 22703622 - 22703680
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggatacc |
456 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || |||||||||||||| |
|
|
| T |
22703622 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattctttgatcggatacc |
22703680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 40332097 - 40332147
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
40332097 |
aacccatttggagttggtctagtggttggcttgaaatcttggagtttgctc |
40332147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 43785502 - 43785452
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||||||||||| ||| |||||| |
|
|
| T |
43785502 |
aacccatttggggttgacctaatggttggcttgggatctttgagattgctc |
43785452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 2103168 - 2103254
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||| ||||||||||| |||| || ||||||||| || |||||||||||||| |||| |
|
|
| T |
2103168 |
ttgctctggctttaaatggggcccccgcaagtgggcggtgggattggtccc-tcggattagtcgattcatgatcggataccgagtttt |
2103254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 9683829 - 9683874
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
9683829 |
atttgcggttggcctagtggttgacttgagatctgggagtttgctc |
9683874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 9718185 - 9718140
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
9718185 |
atttgaggttggcctagtggttggcctgagatattggagtttgctc |
9718140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 16374130 - 16374195
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
16374130 |
cccgcaaatggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
16374195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 17279667 - 17279732
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||||||||| |||| ||| |||||||||| ||| ||||||||||||| |||| |
|
|
| T |
17279667 |
cccgcaaacggacggtgggattggtcccctcaaattagtcggtctttggatcggataccgagtttt |
17279732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 22120024 - 22120089
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
22120024 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
22120089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 343 - 384
Target Start/End: Original strand, 22696327 - 22696368
Alignment:
| Q |
343 |
ggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
22696327 |
ggggttggcctagtggttgatttgggatcttggagtgtgctc |
22696368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 23330937 - 23330892
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || |||| ||||| |
|
|
| T |
23330937 |
atttggggttagcctagtggttggcttgggattttagagtgtgctc |
23330892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 351 - 384
Target Start/End: Complemental strand, 24686167 - 24686134
Alignment:
| Q |
351 |
cctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
24686167 |
cctagtggttgacttgggatcttggagtttgctc |
24686134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 345 - 378
Target Start/End: Original strand, 28950877 - 28950910
Alignment:
| Q |
345 |
ggttggcctagtggttggcttgggatcttggagt |
378 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
28950877 |
ggttggcctagtggttggcttggggtcttggagt |
28950910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 29861806 - 29861871
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||| || || ||||||||||||| |||| |
|
|
| T |
29861806 |
cccgcaagtgggcggtgggattgatcccctcgaattagtcgattcttagatcggataccgagtttt |
29861871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 31197726 - 31197791
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||| || || ||||||||| ||| |||| |
|
|
| T |
31197726 |
cccgcaagtggtcggtgggattggtcccctcagattagtcgattcttggatcggatatcgagtttt |
31197791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 40542975 - 40542910
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
40542975 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
40542910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 42913578 - 42913513
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||||| |||| || ||||||| | || || ||||||||||||| |||| |
|
|
| T |
42913578 |
cccgcaagtggacggtgggattggtcccctcggattagttgattcttagatcggataccgagtttt |
42913513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 4e-19; HSPs: 52)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 331 - 384
Target Start/End: Complemental strand, 30807359 - 30807306
Alignment:
| Q |
331 |
gataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30807359 |
gataacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
30807306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 35492904 - 35492955
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35492904 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
35492955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 46576341 - 46576392
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46576341 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
46576392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 30257618 - 30257668
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30257618 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
30257668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 34492778 - 34492728
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34492778 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
34492728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 45529957 - 45529907
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45529957 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
45529907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 25379760 - 25379805
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379760 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
25379805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 53424374 - 53424329
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53424374 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
53424329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 21362936 - 21362987
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21362936 |
taacccatttggggttggcctagtggttgacttgggatcttggagtttgctc |
21362987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 40940818 - 40940869
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40940818 |
taacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
40940869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 45272620 - 45272569
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45272620 |
taacccatttggggttggcctagtcgttggcttgggatcttggagtttgctc |
45272569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 8456353 - 8456303
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8456353 |
aacccatttggggttggcctagtggttggcttgggatcttcgagtttgctc |
8456303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 25289917 - 25289867
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25289917 |
aacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
25289867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 31538041 - 31537991
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31538041 |
aacccatttggggttggcctagtggttggcttaggatcttggagtttgctc |
31537991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 40133652 - 40133602
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40133652 |
aacccatttggggttggcctagtggttggcttgggattttggagtttgctc |
40133602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 48977382 - 48977432
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48977382 |
aacccatttggggttggcctagtggttgacttgggatcttggagtttgctc |
48977432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 50582986 - 50583036
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50582986 |
aacccatttggggttggcctagtggttggtttgggatcttggagtttgctc |
50583036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 52455847 - 52455802
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52455847 |
atttggggttggcctagtggttggctagggatcttggagtttgctc |
52455802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 339 - 383
Target Start/End: Original strand, 4462632 - 4462676
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4462632 |
atttggggttggcctagtggttggcttgagatcttggagtttgct |
4462676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 334 - 385
Target Start/End: Complemental strand, 18177090 - 18177039
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
18177090 |
aacccatttggggttggcctagtggttgacttgagatcttggagtttgctct |
18177039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 341 - 384
Target Start/End: Original strand, 26174114 - 26174157
Alignment:
| Q |
341 |
ttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26174114 |
ttggagttggcctagtggttggcttgggatcttggagtttgctc |
26174157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 49258466 - 49258415
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49258466 |
taacccatttggggtttgcctagtggttggcttgggatcttgcagtttgctc |
49258415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 379 - 449
Target Start/End: Original strand, 51532898 - 51532971
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatc |
449 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
51532898 |
ttgctctaactttaaatgggacccccgcaagtggacggtgggattggtcccctcagattagtcggttcttgatc |
51532971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 4252599 - 4252549
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
4252599 |
aacccatttggggttggcctagtggttggcttgagatcttggagtgtgctc |
4252549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 7485728 - 7485678
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
7485728 |
aacccatttggggttggcatagtggttgacttgggatcttggagtttgctc |
7485678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 25344255 - 25344210
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
25344255 |
atttggggttggcctagtggttgacttgggatcttcgagtttgctc |
25344210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 347 - 384
Target Start/End: Original strand, 26108299 - 26108336
Alignment:
| Q |
347 |
ttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26108299 |
ttggcctagtggttggcttgggatcttggagtttgctc |
26108336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 52821833 - 52821788
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52821833 |
atttggtgttggcctagtggttgacttgggatcttggagtttgctc |
52821788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 344 - 384
Target Start/End: Complemental strand, 15566692 - 15566652
Alignment:
| Q |
344 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15566692 |
gggttggcctagtggttggcttgagatcttggagtttgctc |
15566652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 344 - 384
Target Start/End: Original strand, 32151428 - 32151468
Alignment:
| Q |
344 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32151428 |
gggttggcctagtggttgacttgggatcttggagtttgctc |
32151468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 45529819 - 45529755
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || ||||||||||||||| |||| |
|
|
| T |
45529819 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgatcggataccgagtttt |
45529755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 53233975 - 53233911
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || ||||||||||||||| |||| |
|
|
| T |
53233975 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgatcggataccgagtttt |
53233911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 337 - 380
Target Start/End: Original strand, 11390599 - 11390642
Alignment:
| Q |
337 |
ctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
11390599 |
ctatttggggttggcctagtggttggtttgagatcttggagttt |
11390642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 7470418 - 7470368
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
7470418 |
aacccatttggggtttgcctagtggttgacttgagatcttggagtttgctc |
7470368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 380
Target Start/End: Original strand, 9842915 - 9842961
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
9842915 |
aacccatttggggttggtctagtggttggtttgggatcttggagttt |
9842961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 26174222 - 26174310
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
26174222 |
ttgctctggctttaaatagggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
26174310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 55287797 - 55287847
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
55287797 |
aacccatttggggttggcatagtggttggcttggaatcttagagtttgctc |
55287847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 333 - 383
Target Start/End: Complemental strand, 55371489 - 55371439
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
55371489 |
taacctatttgaggttggcctagtggttggcttgcgattttggagtatgct |
55371439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 10190807 - 10190742
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
10190807 |
cccgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
10190742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 15566565 - 15566500
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||| || || ||||||||||||| |||| |
|
|
| T |
15566565 |
cccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagtttt |
15566500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 459
Target Start/End: Original strand, 26158943 - 26159004
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaa |
459 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||| || |||||||||||||| |
|
|
| T |
26158943 |
cccgcaagtgggcggtgggattgatcccctcggattagtcggtccttggatcggataccgaa |
26159004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 36660769 - 36660814
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
36660769 |
atttggggttgacctagtggttggtttaggatcttggagtttgctc |
36660814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 335 - 383
Target Start/End: Complemental strand, 50195481 - 50195433
Alignment:
| Q |
335 |
acctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| ||||||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
50195481 |
acctgtttggggttagcatagtggttgtcttgggatcttggagtttgct |
50195433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 352 - 384
Target Start/End: Complemental strand, 53234095 - 53234063
Alignment:
| Q |
352 |
ctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
53234095 |
ctagtggttggcttgggatcttggagtttgctc |
53234063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 29915473 - 29915422
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||| |||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
29915473 |
taacccatttagggttgacctaatggttgacttgggatcttggagtttgctc |
29915422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 29964626 - 29964575
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||| |||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
29964626 |
taacccatttagggttgacctaatggttgacttgggatcttggagtttgctc |
29964575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 30257733 - 30257821
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||| |||||| |||| |||| || ||||||||| || || |||||||||||||||||| |
|
|
| T |
30257733 |
ttgctctggctttaaatggggcccccgcaagtgggcggtggcattggtcccctcggattagtcgattcttggatcggataccgaatttt |
30257821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 8097344 - 8097279
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
8097344 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
8097279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 403 - 463
Target Start/End: Complemental strand, 10083880 - 10083819
Alignment:
| Q |
403 |
caagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
10083880 |
caagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
10083819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 16140296 - 16140341
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||| |||||| |
|
|
| T |
16140296 |
atttggggttggcctagtgattagtttgggatcttggagcttgctc |
16140341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 24165780 - 24165715
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
24165780 |
cccgcaagtgggcggtgggattgttcccctcggattagtcgattcttggatcggataccgagtttt |
24165715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 53848499 - 53848434
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
53848499 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
53848434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 49; Significance: 2e-18; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 332 - 384
Target Start/End: Complemental strand, 8612 - 8560
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8612 |
ataacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
8560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 2e-18; HSPs: 30)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 332 - 384
Target Start/End: Original strand, 22576059 - 22576111
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22576059 |
ataacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
22576111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 333 - 385
Target Start/End: Original strand, 34147339 - 34147391
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34147339 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctct |
34147391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 333 - 385
Target Start/End: Original strand, 34159955 - 34160007
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34159955 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctct |
34160007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 9238969 - 9239019
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9238969 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
9239019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 12591631 - 12591681
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12591631 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
12591681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 15360301 - 15360251
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15360301 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
15360251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 340 - 384
Target Start/End: Original strand, 11448871 - 11448915
Alignment:
| Q |
340 |
tttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11448871 |
tttggggttggcctagtggttggcttgggatcttggagtttgctc |
11448915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 332 - 384
Target Start/End: Original strand, 33499466 - 33499518
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33499466 |
ataacccatttggggttggcctggtggttggcttgggatcttggagtttgctc |
33499518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 3222838 - 3222787
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3222838 |
taacccatttggggttggcctagtggttggcttgggatcttgcagtttgctc |
3222787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 13753234 - 13753284
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13753234 |
aacccatttggggttggcctagtggttggctttggatcttggagtttgctc |
13753284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 333 - 383
Target Start/End: Complemental strand, 21148714 - 21148664
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21148714 |
taacccatttggagttggcctagtggttggcttgggatcttggagtttgct |
21148664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 9843937 - 9843982
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9843937 |
atttggggttggtctagtggttggcttgggatcttggagtttgctc |
9843982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 21982518 - 21982473
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21982518 |
atttggggttggcctagtggttggcttgggatcttgaagtttgctc |
21982473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 11007158 - 11007209
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11007158 |
taacccatttggggttgatctagtggttggcttgggatcttggagtttgctc |
11007209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 28672060 - 28672111
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
28672060 |
taacccatttggggttggcctagtggttgacttgagatcttggagtttgctc |
28672111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 334 - 383
Target Start/End: Complemental strand, 5360274 - 5360225
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5360274 |
aacccatttggagttggcctggtggttggcttgggatcttggagtttgct |
5360225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 8479311 - 8479356
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
8479311 |
atttggggttggcctagtggttgacttgggatcttggagtgtgctc |
8479356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 332 - 384
Target Start/End: Original strand, 9208244 - 9208296
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9208244 |
ataacccatttggggttgttctagtggttggattgggatcttggagtttgctc |
9208296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 654349 - 654299
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
654349 |
aacccatttgggtttggcctagtggctgacttgggatcttggagtttgctc |
654299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 17081257 - 17081207
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||| |||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
17081257 |
aacccatttgaggttagtctagtggttggcttaggatcttggagtttgctc |
17081207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 402 - 463
Target Start/End: Complemental strand, 33718531 - 33718469
Alignment:
| Q |
402 |
gcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||| || || ||||||||| | |||||| |
|
|
| T |
33718531 |
gcaagtggacggtgggattgatcccctcggattagtcgattcttggatcggatatcaaatttt |
33718469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 380
Target Start/End: Complemental strand, 33718661 - 33718615
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| |||| ||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
33718661 |
aacccatttagggttggtctagtggttggtttgggatcttggagttt |
33718615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 654211 - 654146
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
654211 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagtttt |
654146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 1345067 - 1345132
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||||| |||| | ||||||||| || || ||||||||||||| |||| |
|
|
| T |
1345067 |
cccgcaagtggacggtgggattggtccccttggattagtcgattcttggatcggataccgagtttt |
1345132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 3222701 - 3222636
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
3222701 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
3222636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 10377714 - 10377759
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||||||||| ||||| |
|
|
| T |
10377714 |
atttggggttggcccagttgttggcttgagatcttggagtgtgctc |
10377759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 14212891 - 14212936
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||| ||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
14212891 |
atttgggattgacctaatggttggctcgggatcttggagtttgctc |
14212936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 21148576 - 21148511
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || ||| |||||||||||| |||| |
|
|
| T |
21148576 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
21148511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 34147478 - 34147543
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
34147478 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34147543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 34160094 - 34160159
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
34160094 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34160159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 2e-18; HSPs: 67)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 332 - 384
Target Start/End: Complemental strand, 32059645 - 32059593
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32059645 |
ataacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
32059593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 13108653 - 13108602
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13108653 |
taacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
13108602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 22392695 - 22392745
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22392695 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
22392745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 23270725 - 23270675
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23270725 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
23270675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 25586926 - 25586976
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25586926 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
25586976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 4603776 - 4603821
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4603776 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
4603821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 8484859 - 8484814
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8484859 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
8484814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 38631159 - 38631114
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38631159 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
38631114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 332 - 384
Target Start/End: Complemental strand, 15641310 - 15641258
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15641310 |
ataacccatttggggttagcctagtggttggcttgggatcttggagtttgctc |
15641258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 11926706 - 11926655
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11926706 |
taacccatttggggttggcctagtggttggtttgggatcttggagtttgctc |
11926655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 13038658 - 13038607
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13038658 |
taacccatttggggttggcctagtggttggtttgggatcttggagtttgctc |
13038607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 3715112 - 3715062
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3715112 |
aaccaatttggggttggcctagtggttggtttgggatcttggagtttgctc |
3715062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 12317353 - 12317303
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12317353 |
aacccatttggggttggcctagtggttggcttggaatcttggagtttgctc |
12317303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 31288149 - 31288099
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31288149 |
aacccattttgggttggcctagtggttggcttgggatcttggagtttgctc |
31288099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 37397707 - 37397757
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
37397707 |
aacctatttggggttggtctagtggttggcttgtgatcttggagtttgctc |
37397757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 334 - 383
Target Start/End: Original strand, 15931053 - 15931102
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15931053 |
aacccatttggggttggcctagtggttagcttgggatcttggagtttgct |
15931102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 25750809 - 25750764
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25750809 |
atttggggttggcctagtggttgacttgggatcttggagtttgctc |
25750764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 36954817 - 36954862
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36954817 |
atttggggttggcctagtggttgccttgggatcttggagtttgctc |
36954862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 344 - 384
Target Start/End: Complemental strand, 33709694 - 33709654
Alignment:
| Q |
344 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33709694 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
33709654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 1827734 - 1827683
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
1827734 |
taacccatttggggttgacctagtggttggcttgagatcttggagtttgctc |
1827683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 332 - 383
Target Start/End: Complemental strand, 6014484 - 6014434
Alignment:
| Q |
332 |
ataacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6014484 |
ataacctatttggg-ttggcctagtgattggcttgggatcttggagtttgct |
6014434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 27498935 - 27498884
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
27498935 |
taacccatttggggttgacctagtggttggcttggaatcttggagtttgctc |
27498884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 30485822 - 30485872
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
30485822 |
aacccatttggggttggcccagcggttggcttgggatcttggagtttgctc |
30485872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 34049816 - 34049866
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
34049816 |
aacccatttggggttgggctagtagttggcttgggatcttggagtttgctc |
34049866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 34310136 - 34310186
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34310136 |
aacccatttggggttggcctagtggtcggcttggaatcttggagtttgctc |
34310186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 15971320 - 15971275
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15971320 |
atttagggttggcttagtggttggcttgggatcttggagtttgctc |
15971275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 19145609 - 19145564
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
19145609 |
atttggggttggcctagtggttgacttgggatcttggagtatgctc |
19145564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 42006792 - 42006837
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
42006792 |
atttggggttgggctagtggttggcttgagatcttggagtttgctc |
42006837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 15641170 - 15641106
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || ||||||||||||||| |||| |
|
|
| T |
15641170 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgatcggataccgagtttt |
15641106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 399 - 458
Target Start/End: Original strand, 22648154 - 22648214
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccga |
458 |
Q |
| |
|
|||||||||| | ||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
22648154 |
cccgcaagtgaatggtgggattgatcccctcagattagtcggtctttggatcggataccga |
22648214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 33025473 - 33025524
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
33025473 |
taacccatttggggttggcctcgcggttggcttgggatcttggagtgtgctc |
33025524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 384
Target Start/End: Original strand, 38684209 - 38684252
Alignment:
| Q |
341 |
ttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38684209 |
ttggggttggcccagtggttgacttgggatcttggagtttgctc |
38684252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 380
Target Start/End: Complemental strand, 7085829 - 7085783
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7085829 |
aacccatttggggctggcttagtggttggcttgggatcttggagttt |
7085783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 339 - 385
Target Start/End: Complemental strand, 27487753 - 27487707
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
27487753 |
atttggggttggcctagtggttgatttgggattttggagtttgctct |
27487707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 384
Target Start/End: Complemental strand, 2499380 - 2499331
Alignment:
| Q |
335 |
acctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||| |||||| || |||||||||||||| ||||||| |
|
|
| T |
2499380 |
acctatttggggttggcttagtggctgacttgggatcttggaatttgctc |
2499331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 13659310 - 13659245
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||| ||| || || |||||||||||||||||| |
|
|
| T |
13659310 |
cccgcaagtgggcggtgggattgatcccctcggattaatcgattcttggatcggataccgaatttt |
13659245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 22253343 - 22253298
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
22253343 |
atttggggttggtctagtggttggcttgggatctttgactttgctc |
22253298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 22392820 - 22392885
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggttttt-gatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||| |||| |||| |||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
22392820 |
cccgcaagtgggcggtggaattggtcccctcagattagtcgatttttggatcggataccgagtttt |
22392885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 346 - 383
Target Start/End: Original strand, 42193491 - 42193528
Alignment:
| Q |
346 |
gttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42193491 |
gttggcctagtggttgacttgggatcttggagtttgct |
42193528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 404 - 463
Target Start/End: Original strand, 41084120 - 41084180
Alignment:
| Q |
404 |
aagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||||| ||| |||||||||||| |||| |
|
|
| T |
41084120 |
aagtgggcggtaggattgatcccttcggattagtcggttcttgaatcggataccgagtttt |
41084180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 9659399 - 9659338
Alignment:
| Q |
379 |
ttgctctagctttaaataggccc---gcaagtggacggtgggattgatcccttcagattagt |
437 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
9659399 |
ttgctctggctttaaatgggccccccgcaagtggacggtgggattggtcccttcggattagt |
9659338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 11465111 - 11465060
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
11465111 |
taacccatttcgggttggcctagtgattggcttgaaatcttggagtttgctc |
11465060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 16616112 - 16616163
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||| | ||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
16616112 |
taacccatttgagattggcttagtagttggcttgggatcttggagtttgctc |
16616163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 204227 - 204177
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||| ||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
204227 |
aacctctttggagttggtctagtggttgacttgtgatcttggagtttgctc |
204177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 402 - 463
Target Start/End: Original strand, 4603912 - 4603974
Alignment:
| Q |
402 |
gcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||||||||| || ||||||||||||| |||| |
|
|
| T |
4603912 |
gcaagtggacggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
4603974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 5067295 - 5067345
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||| ||||| |||||||||| ||||||||||| |||||||||| |
|
|
| T |
5067295 |
aacccatttggagttggtctagtggttgacttgggatcttcgagtttgctc |
5067345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 402 - 463
Target Start/End: Complemental strand, 24158228 - 24158166
Alignment:
| Q |
402 |
gcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
|||||||| ||||| ||||| |||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
24158228 |
gcaagtgggcggtgagattggtcccctcagattagtcggtccttgaatcggataccgaatttt |
24158166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 398 - 463
Target Start/End: Original strand, 37495185 - 37495251
Alignment:
| Q |
398 |
gcccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
37495185 |
gcccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
37495251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 930683 - 930638
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| || |||||||||| |
|
|
| T |
930683 |
atttggggttggcccagtggttggcttgagattttagagtttgctc |
930638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 7085691 - 7085626
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || ||| |||||||||||| |||| |
|
|
| T |
7085691 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
7085626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 8484726 - 8484661
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
8484726 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
8484661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 400 - 456
Target Start/End: Complemental strand, 10869629 - 10869572
Alignment:
| Q |
400 |
ccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggatacc |
456 |
Q |
| |
|
|||||||||| ||||||||||| |||| || |||||||||||| || ||||||||||| |
|
|
| T |
10869629 |
ccgcaagtgggcggtgggattggtcccctcggattagtcggttcttggatcggatacc |
10869572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 13038520 - 13038455
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||| || || |||||||||| ||||||| |
|
|
| T |
13038520 |
cccgcaagtgggcggtgggattgatcccctcgaattagtcgattcttggatcggatactgaatttt |
13038455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 18207339 - 18207404
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
18207339 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
18207404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 19145477 - 19145412
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||| |||| || ||||||||||||| |||| |
|
|
| T |
19145477 |
cccgcaagtgggcggtgggattggtcccctcggattagttggttcttggatcggataccgagtttt |
19145412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 341 - 378
Target Start/End: Original strand, 19230476 - 19230513
Alignment:
| Q |
341 |
ttggggttggcctagtggttggcttgggatcttggagt |
378 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
19230476 |
ttggggttggcctagtggttagtttgggatcttggagt |
19230513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 19456276 - 19456211
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
19456276 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
19456211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 21042723 - 21042678
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
21042723 |
atttggggttggtttagtgattggtttgggatcttggagtttgctc |
21042678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 21236427 - 21236362
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||||||| || ||| |||||||||||| |||| |
|
|
| T |
21236427 |
cccgcaagtgggcggtgggattagtcccctcagattagtcgattcttgaatcggataccgagtttt |
21236362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 22693067 - 22693132
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
22693067 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
22693132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 27498796 - 27498731
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
27498796 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
27498731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 407 - 463
Target Start/End: Complemental strand, 28614543 - 28614486
Alignment:
| Q |
407 |
tggacggtgggattgatcccttcagattagtcggttttt-gatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||| ||||||||||||| |||| |
|
|
| T |
28614543 |
tggacggtgggattgatcccctcgaattagtcgatttttggatcggataccgagtttt |
28614486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 32059505 - 32059440
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||||| || ||||||||||||| |||| |
|
|
| T |
32059505 |
cccgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
32059440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 35425145 - 35425210
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| ||| || ||||||||| || || |||||||||||||||||| |
|
|
| T |
35425145 |
cccgcaagtgggcggtgggattggtcctctcggattagtcgattcttggatcggataccgaatttt |
35425210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 351 - 384
Target Start/End: Original strand, 37495058 - 37495091
Alignment:
| Q |
351 |
cctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
37495058 |
cctagtggttggcttgagatcttggagtttgctc |
37495091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 405 - 442
Target Start/End: Complemental strand, 38086413 - 38086376
Alignment:
| Q |
405 |
agtggacggtgggattgatcccttcagattagtcggtt |
442 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
38086413 |
agtggacggtgggattggtcccttcaaattagtcggtt |
38086376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 40330632 - 40330677
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
40330632 |
atttgaggttggcttagtggttagcttgagatcttggagtttgctc |
40330677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0576 (Bit Score: 47; Significance: 3e-17; HSPs: 1)
Name: scaffold0576
Description:
Target: scaffold0576; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 5285 - 5235
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5285 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
5235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0217 (Bit Score: 47; Significance: 3e-17; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 7512 - 7462
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7512 |
aacctatttggggttggcctagtagttggcttgggatcttggagtttgctc |
7462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 3e-17; HSPs: 46)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 5609405 - 5609355
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5609405 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
5609355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 25852208 - 25852258
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25852208 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
25852258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 32986191 - 32986241
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32986191 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
32986241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 34722164 - 34722214
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34722164 |
aacctatttggggttggcttagtggttggcttgggatcttggagtttgctc |
34722214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 40059055 - 40059005
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40059055 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
40059005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 46714386 - 46714436
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46714386 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
46714436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 54127545 - 54127495
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54127545 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
54127495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 20566348 - 20566393
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20566348 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
20566393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 19660736 - 19660685
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19660736 |
taacccatttggagttggcctagtggttggcttgggatcttggagtttgctc |
19660685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 33696483 - 33696432
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33696483 |
taacccatttagggttggcctagtggttggcttgggatcttggagtttgctc |
33696432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 334 - 385
Target Start/End: Complemental strand, 35674944 - 35674893
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctct |
385 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35674944 |
aacccatttggggttggccaagtggttggcttgggatcttggagtttgctct |
35674893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 1985830 - 1985880
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1985830 |
aacccatttgggattggcctagtggttggcttgggatcttggagtttgctc |
1985880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 52983613 - 52983663
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52983613 |
aacccatttggggttggcctagtggttggcttgagatcttggagtttgctc |
52983663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 13873493 - 13873448
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13873493 |
atttggggttggcctagtggtttgcttgggatcttggagtttgctc |
13873448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 344 - 384
Target Start/End: Original strand, 35229172 - 35229212
Alignment:
| Q |
344 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35229172 |
gggttggcctagtggttggcttgggatcttggagtttgctc |
35229212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 44343506 - 44343558
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggtt-ggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
44343506 |
taacctatttggggttgggctagtggtttggcttgggatcttggagtttgctc |
44343558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 384
Target Start/End: Complemental strand, 55961939 - 55961895
Alignment:
| Q |
340 |
tttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55961939 |
tttgggattggcctagtggttggcttgggatcttggagtttgctc |
55961895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 41621800 - 41621749
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
41621800 |
taacccatttggggttggcctaatggttggcttgagatcttggagtttgctc |
41621749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 379 - 463
Target Start/End: Complemental strand, 5609290 - 5609202
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||||||||||||||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
5609290 |
ttgctctggctttaaatggggcccccgcaagtggacggtgggattgatcccctcggattagtcgattcttggatcggataccgagtttt |
5609202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 380
Target Start/End: Complemental strand, 22625273 - 22625227
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22625273 |
aacccatttgaggttggcctagtggttggcttgggatcttggagttt |
22625227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 384
Target Start/End: Complemental strand, 27528990 - 27528948
Alignment:
| Q |
342 |
tggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27528990 |
tggggttggcttagtggttggcttgggatcttggagtttgctc |
27528948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 34844961 - 34844911
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34844961 |
aacccatttggggttggcctagtggtttgcttgagatcttggagtttgctc |
34844911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 34835528 - 34835573
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
34835528 |
atttggggttggtctagtggttggcttgggatcttagagtttgctc |
34835573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 42245745 - 42245790
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
42245745 |
atttggggttggcctagtggttgacttgggatcttagagtttgctc |
42245790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 51535612 - 51535657
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51535612 |
atttagggttggcctagtggttgacttgggatcttggagtttgctc |
51535657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 379 - 463
Target Start/End: Complemental strand, 19660620 - 19660532
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||| |||||||||||||||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
19660620 |
ttgctctggctttaaacagggcccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagtttt |
19660532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 338 - 380
Target Start/End: Original strand, 32942368 - 32942410
Alignment:
| Q |
338 |
tatttggggttggcctagtggttggcttgggatcttggagttt |
380 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
32942368 |
tatttggggttggtctagtggttggcttgagatcttggagttt |
32942410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 33992620 - 33992670
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
33992620 |
aacccatttagggttgacctagtggttggtttgggatcttggagtttgctc |
33992670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 411 - 459
Target Start/End: Original strand, 39288991 - 39289040
Alignment:
| Q |
411 |
cggtgggattgatcccttcagattagtcggtttttg-atcggataccgaa |
459 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
39288991 |
cggtgggattggtcccttcagattagtcggtctttgcatcggataccgaa |
39289040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 43719263 - 43719218
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
43719263 |
atttggggttggtctagtggttggtttgagatcttggagtttgctc |
43719218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 376
Target Start/End: Complemental strand, 45787901 - 45787864
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttgga |
376 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45787901 |
atttggggttggcctagtggttggcttggaatcttgga |
45787864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 341 - 381
Target Start/End: Original strand, 10125783 - 10125823
Alignment:
| Q |
341 |
ttggggttggcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10125783 |
ttggagttggcctagtggttgacttgggatcttggagtttg |
10125823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 401 - 463
Target Start/End: Original strand, 23639758 - 23639821
Alignment:
| Q |
401 |
cgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
23639758 |
cgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23639821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 401 - 463
Target Start/End: Original strand, 23645416 - 23645479
Alignment:
| Q |
401 |
cgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
23645416 |
cgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23645479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 338 - 384
Target Start/End: Complemental strand, 9646415 - 9646369
Alignment:
| Q |
338 |
tatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||| |||| ||||| |
|
|
| T |
9646415 |
tatttggggttggtctagtggttggtttgggatctttgagtgtgctc |
9646369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 13771686 - 13771636
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
13771686 |
aacccatttggggttggtctgatggttggcttgggatcttgaagtttgctc |
13771636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 333 - 379
Target Start/End: Complemental strand, 36131714 - 36131668
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtt |
379 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
36131714 |
taacccatttggggttggcatagtggtttgcttgggattttggagtt |
36131668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 379 - 463
Target Start/End: Complemental strand, 45787792 - 45787704
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||||||||||| |||| || |||||||| || || ||||||||||||| |||| |
|
|
| T |
45787792 |
ttgctctggctttaaacagggcccccgcaagtggacggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
45787704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 347 - 384
Target Start/End: Original strand, 2351020 - 2351057
Alignment:
| Q |
347 |
ttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
2351020 |
ttggcctagtggttggcttggaatcttgaagtttgctc |
2351057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 403 - 463
Target Start/End: Original strand, 4064996 - 4065057
Alignment:
| Q |
403 |
caagtggacggtgggattgatcccttcagattagtcggttttt-gatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||||| |||| || ||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
4064996 |
caagtgggcggtgggattggtcccctcggattagtcgatttttggatcggatatcgaatttt |
4065057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 13550207 - 13550252
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
13550207 |
atttgcggttggcctagtggttgacttgagatctgggagtttgctc |
13550252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 13584452 - 13584407
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
13584452 |
atttgaggttggcctagtggttggcctgagatattggagtttgctc |
13584407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 34844823 - 34844758
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
34844823 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
34844758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 403 - 463
Target Start/End: Original strand, 37302623 - 37302684
Alignment:
| Q |
403 |
caagtggacggtgggattgatcccttcagattagtcggtttttga-tcggataccgaatttt |
463 |
Q |
| |
|
||||||| || |||||||| ||||||| ||||||||| || |||| |||||||||||||||| |
|
|
| T |
37302623 |
caagtgggcgatgggattggtcccttcggattagtcgattcttgaatcggataccgaatttt |
37302684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 40058917 - 40058852
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
40058917 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
40058852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 51595154 - 51595219
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||| ||| || || ||||||||||||| |||| |
|
|
| T |
51595154 |
cccgcaagtggacggtggaattgatctcttcggattaatcgattcttggatcggataccgagtttt |
51595219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 3e-17; HSPs: 47)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 18976628 - 18976578
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18976628 |
aacccatttggggttggcctagtggttggcttgggatcttggagtttgctc |
18976578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 328 - 384
Target Start/End: Complemental strand, 11941419 - 11941363
Alignment:
| Q |
328 |
tgagataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11941419 |
tgagttaacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
11941363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 33827776 - 33827726
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33827776 |
aacccatttggggttggcctagtggttggcttgggatcttggagattgctc |
33827726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 44946256 - 44946206
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44946256 |
aacccatttggggttggtctagtggttggcttgggatcttggagtttgctc |
44946206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 8192549 - 8192504
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8192549 |
atttggggttggcctagtggttggcttgggatcttggagtgtgctc |
8192504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 44976352 - 44976307
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44976352 |
atttggggttggcctagtggttggcttgggatcttggggtttgctc |
44976307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 330 - 384
Target Start/End: Complemental strand, 4567644 - 4567590
Alignment:
| Q |
330 |
agataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| | |||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
4567644 |
agataatccatttggggttggcctagtagttggcttgggatcttgaagtttgctc |
4567590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 15037953 - 15038003
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15037953 |
aacccatttggggttggcctagtggttgactcgggatcttggagtttgctc |
15038003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 27269553 - 27269503
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
27269553 |
aacccatttggggttggcatagtggttggcttgggatcttcgagtttgctc |
27269503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 32845085 - 32845135
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32845085 |
aacccatttggggttggcctagtagttagcttgggatcttggagtttgctc |
32845135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 38784258 - 38784208
Alignment:
| Q |
388 |
ctttaaataggccc-gcaagtggacggtgggattgatcccttcagattagt |
437 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38784258 |
ctttaaataggccccgcaagtggacggtgagattgatcccttcagattagt |
38784208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 17324765 - 17324810
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
17324765 |
atttggggttggcctagtggttggtttggtatcttggagtttgctc |
17324810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 331 - 384
Target Start/End: Original strand, 24195995 - 24196048
Alignment:
| Q |
331 |
gataacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
24195995 |
gataacccatttggggttggcctagtggttggcttgggattttggggttcgctc |
24196048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 333 - 381
Target Start/End: Complemental strand, 30467034 - 30466986
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttg |
381 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
30467034 |
taacccatttggggttggcctagtggttggtttgggatattggagtttg |
30466986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 6714485 - 6714434
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
6714485 |
taacccatttgggattggcctaatggttggcttgagatcttggagtttgctc |
6714434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 41313985 - 41314036
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
41313985 |
taacccatttggggttgccgtagtggttggtttgggatcttggagtttgctc |
41314036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 342 - 384
Target Start/End: Complemental strand, 4618880 - 4618838
Alignment:
| Q |
342 |
tggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4618880 |
tggggttggcctagtggttggcttggaatcttggagtatgctc |
4618838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 399 - 441
Target Start/End: Original strand, 18708609 - 18708651
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt |
441 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
18708609 |
cccgcaaatggacggtgggattgatcccctcagattagtcggt |
18708651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 25293160 - 25293210
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||| |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
25293160 |
aacccatttgaggttggtctagtggttgacttgggatcttggagtttgctc |
25293210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 399 - 441
Target Start/End: Complemental strand, 26176263 - 26176221
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt |
441 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26176263 |
cccgcaagtggacggtgggattggacccttcagattagtcggt |
26176221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 350 - 384
Target Start/End: Original strand, 27290598 - 27290632
Alignment:
| Q |
350 |
gcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27290598 |
gcctagtggttggcttgggatcttggagtttgctc |
27290632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 918897 - 918852
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||| |
|
|
| T |
918897 |
atttggggttgacctagtggttggcttgggattttgaagtttgctc |
918852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 4852557 - 4852602
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
4852557 |
atttggggttgacctagtggttgacttggaatcttggagtttgctc |
4852602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 13599390 - 13599325
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||||| ||| || |||||||||||||||||| |
|
|
| T |
13599390 |
cccgcaagtggacggtgagattgatcccctcatattagtgggtcattggatcggataccgaatttt |
13599325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 15038091 - 15038156
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||| || || ||||||||||||| |||| |
|
|
| T |
15038091 |
cccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagtttt |
15038156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 41329842 - 41329887
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
41329842 |
atttggggttggcctagtggttagtttgggatcttagagtttgctc |
41329887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 400 - 463
Target Start/End: Original strand, 5394150 - 5394214
Alignment:
| Q |
400 |
ccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
5394150 |
ccgcaagtgggcggtgggattggtccgttcggattagtcggtccttagatcggataccgaatttt |
5394214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 333 - 373
Target Start/End: Original strand, 20297556 - 20297596
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatctt |
373 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
20297556 |
taacccatttggggttggcccagtggttggcttgggatctt |
20297596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 399 - 439
Target Start/End: Complemental strand, 44976218 - 44976178
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcg |
439 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
44976218 |
cccgcaagtgggcggtgggattgatcccttcggattagtcg |
44976178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 353 - 384
Target Start/End: Complemental strand, 10582174 - 10582143
Alignment:
| Q |
353 |
tagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10582174 |
tagtggttggcttgggatcttggagtttgctc |
10582143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 344 - 378
Target Start/End: Complemental strand, 19606038 - 19606004
Alignment:
| Q |
344 |
gggttggcctagtggttggcttgggatcttggagt |
378 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
19606038 |
gggttgccctagtggttggcttgggatcttggagt |
19606004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 24196113 - 24196199
Alignment:
| Q |
379 |
ttgctctagctttaaataggccc-gcaagtggacggtgggattgatcccttcagattagtcg-gtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| |||||||| ||||| |||||||| ||||||||||| |||| || ||||||||| |||||||| ||||||||| |||| |
|
|
| T |
24196113 |
ttgctctggctttaaacgggccccgcaagtgggcggtgggattggtcccctcggattagtcgattttttgattggataccgagtttt |
24196199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 379 - 463
Target Start/End: Original strand, 31778140 - 31778228
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||| ||||| ||| ||||||||||| ||| || ||||||||||||| |||| |
|
|
| T |
31778140 |
ttgctctggctttaaatggggcccccgcaagtggacggtgagattggtcctctcagattagtcagttcttggatcggataccgagtttt |
31778228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 334 - 372
Target Start/End: Complemental strand, 36390769 - 36390731
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatct |
372 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
36390769 |
aacccatttggggttggcctagtggttggtttgggatct |
36390731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 399 - 456
Target Start/End: Original strand, 41314123 - 41314181
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggatacc |
456 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||| || || ||||||||||| |
|
|
| T |
41314123 |
cccgcaagtggacggtgggattggtcccctcagattaatcgattcttcgatcggatacc |
41314181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 2140551 - 2140486
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
2140551 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagtttt |
2140486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 11941275 - 11941210
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
11941275 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
11941210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 14946778 - 14946823
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
14946778 |
atttggagttggcctagtggttgacttgagatcttgaagtttgctc |
14946823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 18976520 - 18976455
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||| || || |||||||||||||||||| |
|
|
| T |
18976520 |
cccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgaatttt |
18976455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 19054024 - 19054069
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||| ||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
19054024 |
atttggggtgggcctagtgattggcttgagatcttggagtctgctc |
19054069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 27269409 - 27269344
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| || || ||| ||||||||| |||| |
|
|
| T |
27269409 |
cccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggataggataccgagtttt |
27269344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 403 - 463
Target Start/End: Original strand, 28669009 - 28669070
Alignment:
| Q |
403 |
caagtggacggtgggattgatcccttcagattagtcggttttt-gatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||||| |||| || ||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
28669009 |
caagtgggcggtgggattggtcccctcggattagtcgatttttggatcggataccgagtttt |
28669070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 30466895 - 30466830
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| | ||||||||| ||||||| ||||||||| || || ||||||||||||| |||| |
|
|
| T |
30466895 |
cccgcaagtgggcagtgggattggtcccttcggattagtcgattcttggatcggataccgagtttt |
30466830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 35171932 - 35171997
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttg-atcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || ||| |||||||||||| |||| |
|
|
| T |
35171932 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagtttt |
35171997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 40997548 - 40997503
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
40997548 |
atttgaggtgggtctagtggttgacttgggatcttggagtttgctc |
40997503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 43374395 - 43374330
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||||||||| || || ||||||||||||| |||| |
|
|
| T |
43374395 |
cccgcaagtgagcggtgggattggtcccttcggattagtcgattcttggatcggataccgagtttt |
43374330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 44946118 - 44946053
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| || || ||||||||||||| |||| |
|
|
| T |
44946118 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
44946053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0623 (Bit Score: 46; Significance: 1e-16; HSPs: 2)
Name: scaffold0623
Description:
Target: scaffold0623; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 1254 - 1209
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1254 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
1209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0623; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 379 - 463
Target Start/End: Complemental strand, 1144 - 1057
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||||||||| |||| || |||||||| || ||||||||||||||| |||| |
|
|
| T |
1144 |
ttgctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaattagtcgattcttgatcggataccgagtttt |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 46; Significance: 1e-16; HSPs: 2)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 10891 - 10846
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10891 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
10846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 379 - 463
Target Start/End: Complemental strand, 10781 - 10695
Alignment:
| Q |
379 |
ttgctctagctttaaatagg--cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||| ||||||||||||||||||| |||| || ||||||| || ||||||||||||||| |||| |
|
|
| T |
10781 |
ttgctctggctttaaatggggccccacaagtggacggtgggattggtcccctcgaattagtcaattcttgatcggataccgagtttt |
10695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 46; Significance: 1e-16; HSPs: 3)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 9497 - 9452
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9497 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
9452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 12198 - 12153
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12198 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
12153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #3
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 379 - 463
Target Start/End: Complemental strand, 9387 - 9300
Alignment:
| Q |
379 |
ttgctctagctttaaatagg---cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||||||||| |||| || |||||||| || ||||||||||||||| |||| |
|
|
| T |
9387 |
ttgctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaattagtcgattcttgatcggataccgagtttt |
9300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 41848 - 41797
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41848 |
taacccatttggggttggcctagtggttgacttgggatcttggagtttgctc |
41797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 43; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 14985 - 15035
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14985 |
aacccatttggggttggcctagtggttggcctgggatcttggagtttgctc |
15035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 399 - 463
Target Start/End: Complemental strand, 13112 - 13047
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtt-tttgatcggataccgaatttt |
463 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| | || || ||||||||||||| |||| |
|
|
| T |
13112 |
cccgcaagtggacggtgggattgatcccctcagattagttgattcttggatcggataccgagtttt |
13047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 43; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 40319 - 40369
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40319 |
aacccatttggggttggcctagtggttggcttaggatcttggagtttgctc |
40369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 43; Significance: 0.000000000000007; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 43; E-Value: 0.000000000000007
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 97569 - 97519
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
97569 |
aacccatttggggttggcctagtggttggcttgggatcttgtagtttgctc |
97519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 400 - 441
Target Start/End: Original strand, 5964 - 6005
Alignment:
| Q |
400 |
ccgcaagtggacggtgggattgatcccttcagattagtcggt |
441 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
5964 |
ccgcaagtggacggtgggattggtcacctcagattagtcggt |
6005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 42; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 339 - 384
Target Start/End: Complemental strand, 53069 - 53024
Alignment:
| Q |
339 |
atttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53069 |
atttgggattggcctagtggttggcttgggatcttggagtttgctc |
53024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0240 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0240
Description:
Target: scaffold0240; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 333 - 384
Target Start/End: Complemental strand, 12958 - 12907
Alignment:
| Q |
333 |
taacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12958 |
taacctatttgggattggcctagtggttgacttgggatcttggagttcgctc |
12907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 39; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 66756 - 66806
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
66756 |
aacccatttgggattggtctagtggttggcttgggatcttggagtttgctc |
66806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 66886 - 66951
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggt-ttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||||| || ||||||||||||| |||| |
|
|
| T |
66886 |
cccgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
66951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0200 (Bit Score: 38; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 334 - 383
Target Start/End: Complemental strand, 26746 - 26697
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgct |
383 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
26746 |
aacccatttggggttggcctactggttggcttaggatcttggagtttgct |
26697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0717 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0717
Description:
Target: scaffold0717; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 345 - 384
Target Start/End: Complemental strand, 150 - 111
Alignment:
| Q |
345 |
ggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
150 |
ggttggcctagtggttggcttgtgatcttggagtttgctc |
111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Complemental strand, 8382 - 8332
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
8382 |
aacccatttggggttggtttagtggttggctcgggatcttggagtttgctc |
8332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 35; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 334 - 384
Target Start/End: Original strand, 27770 - 27820
Alignment:
| Q |
334 |
aacctatttggggttggcctagtggttggcttgggatcttggagtttgctc |
384 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
27770 |
aacccatttggggttggtctagtggttggtttgggattttggagtttgctc |
27820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 399 - 463
Target Start/End: Original strand, 32420 - 32484
Alignment:
| Q |
399 |
cccgcaagtggacggtgggattgatcccttcagattagtcggtttttgatcggataccgaatttt |
463 |
Q |
| |
|
||||||||||| |||||||||| |||| || ||||||||| || ||||||||||||||| |||| |
|
|
| T |
32420 |
cccgcaagtgggtggtgggattggtcccctcggattagtcgattcttgatcggataccgagtttt |
32484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0438 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0438
Description:
Target: scaffold0438; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 340 - 373
Target Start/End: Original strand, 5052 - 5085
Alignment:
| Q |
340 |
tttggggttggcctagtggttggcttgggatctt |
373 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
5052 |
tttggggttggcctagtagttggcttgggatctt |
5085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 337 - 374
Target Start/End: Complemental strand, 29342 - 29305
Alignment:
| Q |
337 |
ctatttggggttggcctagtggttggcttgggatcttg |
374 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
29342 |
ctatttgggattggcctagtggttggcttggaatcttg |
29305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University