View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_high_11 (Length: 330)
Name: NF8995_high_11
Description: NF8995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 308
Target Start/End: Original strand, 4289691 - 4289982
Alignment:
| Q |
17 |
tggaggatacgaggaggattttggggttcggggtgatgaatttgaagcctaggatattgtaattcttttgctggactaggaattttacgcctcaaactca |
116 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||| |||| | |||||||| |||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
4289691 |
tggaggatatgaggaggattttggcgttcggggtgatgaattttaagcatgggatattgcaattctttcgctggactagggattttacgcctcaaactca |
4289790 |
T |
|
| Q |
117 |
ggtacaatctcatgttcaaatttgggtgcgtttattgcatttgccacaataatattggagaaggaaaaccctatatgagattgcatcaggtcttggaaca |
216 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4289791 |
ggcacaatctcatgctcaaatttgggtgcgtttattgcatttgccacaataatattggagaaggaaaaccctatatgagattgcatcaggtcttggaaca |
4289890 |
T |
|
| Q |
217 |
ccctttagcatagatgaagctacttaaaataggaggtttggattatatgctagagttcttgtagatgtggatttatctgagaagatatttga |
308 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||| ||||||| |
|
|
| T |
4289891 |
ccctttaccatagatgaagctacagaaaataggaggtttggattatatgctagagttctagtagatgtggatttgtctaagaagctatttga |
4289982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University