View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_low_29 (Length: 316)
Name: NF8995_low_29
Description: NF8995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 316
Target Start/End: Complemental strand, 4289738 - 4289427
Alignment:
| Q |
5 |
gcttcaaattcatcaccccgcaccccccattcctcctcgtatcctccatagaattgaacttgaattcnnnnnnncctttccctaaagggattacagtcca |
104 |
Q |
| |
|
|||| ||||||||||||||| || || | |||||||| ||||||||| | |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4289738 |
gcttaaaattcatcaccccgaacgccaaaatcctcctcatatcctccacaaaattgaacttgaattcaaaaaaaactttccctaaagggattacagtcca |
4289639 |
T |
 |
| Q |
105 |
atttcgcagatttagccacaatcaactgagctttagcttcagggattgcgttgtcaaaggtggatctcccttgctaagagtctatctagcgtgaaggctc |
204 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||| || |
|
|
| T |
4289638 |
attttgcatatttagccacaatcaattgagcttcagcttcagcgattgcgttgtcaaaggtggatctcccttgctaagagtcaatctaacgtgaaggttc |
4289539 |
T |
 |
| Q |
205 |
cgcttgcaatcttcaattccatgctcatactcatcctgagatatcttgactcgaattgtgtcacccataataacctcgatacgtagctgagaaagttgag |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
4289538 |
cgcttgcaatcttcaattccatgctcatactcatcctgagatatcttaactcgaactgtgtcacccataataacctcgataggtagctgataaagttgag |
4289439 |
T |
 |
| Q |
305 |
tgtcaccggaat |
316 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4289438 |
tgtcaccggaat |
4289427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University