View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_low_37 (Length: 290)
Name: NF8995_low_37
Description: NF8995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 9956121 - 9956395
Alignment:
| Q |
1 |
acgggaaattttgtaactaacatttggaaattttcaacagcttcttcttcttgctcatttggtgattcaatctgaaaagcttcgtgcgagagacaatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9956121 |
acgggaaattttgtaactaacatttggaaattttcaacagcttcttcttcttcttcatttggtgattcaatctgaaaagcttcgtgtgagagacaatgga |
9956220 |
T |
 |
| Q |
101 |
gaatctgatacaattggtgaacaaaatacagagagcttgcaccgcactcggcgatcacggcgaggagagcgctttgcctactctttgggacgctcttccc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9956221 |
gaatctcatacaattggtgaacaaaatacagagagcttgcaccgcactcggcgatcacggcgaggagagcgctttgcctactctttgggacgctcttccc |
9956320 |
T |
 |
| Q |
201 |
tccattgccgtcgttggaggacaggtgttactctcgatctaaaagtttttacggtgtagaatgaatgattcttgt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9956321 |
tccattgccgtcgttggaggacaggtgttactctcgatctaaaagtttttacggtgtagaatgaatgattcttgt |
9956395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University