View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8995_low_49 (Length: 234)
Name: NF8995_low_49
Description: NF8995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8995_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 35181472 - 35181257
Alignment:
| Q |
1 |
aaataagtgattgaaatccaaaattaacttgagccctcacttccttgggctatattcagtctatttctgattattattggcttgctgaacatttttacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35181472 |
aaataagtgattgaaatccaaaattaacttgagccctcacttccttgggctatattcagtctatttctgattattattggtttgctgaacatttttacga |
35181373 |
T |
 |
| Q |
101 |
tcatctcaaaattcttttgatttacgtagatgatatagtcttgatcggtgatgacatcacattttaattaaccatgtttaatccatgcttcattcccaat |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35181372 |
tcatctcaaaattcttttgatttacttagatgatatagtcttgataggtgatgacatcacattttaattaaccatgtttgatccatgcttcattcccaat |
35181273 |
T |
 |
| Q |
201 |
ttcaaatcaaagacat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35181272 |
ttcaaatcaaagacat |
35181257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University