View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8996_low_4 (Length: 237)
Name: NF8996_low_4
Description: NF8996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8996_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 5 - 206
Target Start/End: Complemental strand, 12898575 - 12898382
Alignment:
| Q |
5 |
ttcataggatatgacataagtatgtttttaattaatattgaatattttaacaattaagatcattagggtaaaattgttgacaaaataaatgaaggttaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12898575 |
ttcataggatatgacataagtatgtttttatttaatattgaatattttaacaattaagataattagggtaaaattgttgacaaaataaatgaaggttaaa |
12898476 |
T |
 |
| Q |
105 |
attgacnnnnnnnntggtaagttacaacttacaaggttaaacctaattgaaacaacttatcataaaacactataaattagtaaaataaacatgtctattt |
204 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12898475 |
attgac-aaaaaaatggtaag-------ttacaaggttaaacctaattgaaacaacttatcataaaacactataaattagtaaaataaacatgtctattt |
12898384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University