View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8996_low_5 (Length: 237)

Name: NF8996_low_5
Description: NF8996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8996_low_5
NF8996_low_5
[»] chr8 (1 HSPs)
chr8 (5-206)||(12898382-12898575)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 5 - 206
Target Start/End: Complemental strand, 12898575 - 12898382
Alignment:
5 ttcataggatatgacataagtatgtttttaattaatattgaatattttaacaattaagatcattagggtaaaattgttgacaaaataaatgaaggttaaa 104  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
12898575 ttcataggatatgacataagtatgtttttatttaatattgaatattttaacaattaagataattagggtaaaattgttgacaaaataaatgaaggttaaa 12898476  T
105 attgacnnnnnnnntggtaagttacaacttacaaggttaaacctaattgaaacaacttatcataaaacactataaattagtaaaataaacatgtctattt 204  Q
    ||||||        |||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12898475 attgac-aaaaaaatggtaag-------ttacaaggttaaacctaattgaaacaacttatcataaaacactataaattagtaaaataaacatgtctattt 12898384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University