View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8997_low_10 (Length: 423)
Name: NF8997_low_10
Description: NF8997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8997_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 49 - 245
Target Start/End: Original strand, 6920363 - 6920558
Alignment:
| Q |
49 |
caatgggtaatgataaacaactctctgtctgcttgtatttgttttagggaaagaaggtgaactatgtgccattcaaagtaaagtgtattgcatgcatccg |
148 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6920363 |
caatgggtaatgataaa-aactctctgtctgcttgtatttgttttagggaaagaaggtgaaccatgtgccattcaaagtaaagtgcattgcatgcatccg |
6920461 |
T |
|
| Q |
149 |
gggaaaaaggcgaacaaatactcataacttcaaacgaaggataactctttcctaaaaggaatgttcatgctaatattccaaactagcttggtccaaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6920462 |
gggaaaaaggcgaacaaatactcataacttcaaacgaaggataactctttcctaaaaggaatgttcatgctaatattccaaactagcttggcccaaa |
6920558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 252 - 408
Target Start/End: Original strand, 6920589 - 6920745
Alignment:
| Q |
252 |
cataggctgattttagagaaagctgttcataatcagcttgagaccaaagtaattcatcactcctttgctccaatggaatgatattgtattcaacaatatt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
6920589 |
cataggctgattttagagaaagctgttcataatcagcttgagaccaaagtaattcatcactcctttgctccaatggaatgatagtgttttcaacaatatt |
6920688 |
T |
|
| Q |
352 |
caaaagagaaggataagcttgctgcaacaagcttatcctgtataggtatagcacgag |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6920689 |
caaaagagaaggataagcttgctgcaacaagcttatcctgtataggtatagcacgag |
6920745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University