View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8997_low_21 (Length: 228)
Name: NF8997_low_21
Description: NF8997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8997_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 7309972 - 7309764
Alignment:
| Q |
1 |
ctttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagcgacaagcatgaatgatggaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7309972 |
ctttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagc-------atgaatgatggaaca |
7309880 |
T |
|
| Q |
101 |
tggcggcagaatgttatgaagaaaaatattgcagcttattggaacttgtttgtttattgtactaattttacagagcctattttcacccgagctaaaactc |
200 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7309879 |
tggcggcagaatgctatgaagcaaaatattgcagctttttggaacttgtttgtttattgtactaattttatagagcctattttcacccgagctaaaactc |
7309780 |
T |
|
| Q |
201 |
cattgctatttatgag |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7309779 |
cattgctatttatgag |
7309764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 88 - 202
Target Start/End: Original strand, 7330063 - 7330181
Alignment:
| Q |
88 |
gaatgatggaacatggcggcagaatgttatgaagaaaaatattgcagcttattgg------aacttgtttgtttattgtactaattttacagagcctatt |
181 |
Q |
| |
|
|||||||||| |||||| || ||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||| | || ||||| |
|
|
| T |
7330063 |
gaatgatggagcatggctgcggaatgctatgaagaaaaatattggagcttattggaactacaacttgtttggttattgtactcatttt--atagtctatt |
7330160 |
T |
|
| Q |
182 |
ttcacccgagctaaaactcca |
202 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7330161 |
ttcacccgagctaaaactcca |
7330181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 7330012 - 7330056
Alignment:
| Q |
16 |
tattgttgaaattggttcattttgaattgtagatctacaacctga |
60 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7330012 |
tattgtttaaatgggttcattttgaattgtagatctacaacctga |
7330056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University