View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8998_low_5 (Length: 352)
Name: NF8998_low_5
Description: NF8998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8998_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 17 - 333
Target Start/End: Original strand, 49684670 - 49684989
Alignment:
| Q |
17 |
agaatgcacccattctgcttgttcgtaatagcaaaggaaagtcgtccctagaggagaa---gaggtaaagggtagctctatgttcagcagtggtgctgtt |
113 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49684670 |
agaatgcatccattctgcctgttcgtaatagcaaaggaaagtcgtccctagaggagaagaagaggtaaagggtagctctatgttcagcagtggtgctgtt |
49684769 |
T |
 |
| Q |
114 |
ggtgatgataatagctttagggttttggctttaacttaatttgatcagaaactgaaactactggaattagttttaaaagatgaaaaacgatatacatagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49684770 |
ggtgatgataatagctttagggttttggctttaacttaatttgatcagaaactgaaactactggaattagttttaaaagatgaaaaacgatatacatagt |
49684869 |
T |
 |
| Q |
214 |
tttgcactttcttaataagaaaagaaaaacaacgcattactgaacaagttcaagctgttgaattgctagtacttgttggttatttggcggttcattttcg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
49684870 |
tttgcactttcttaataagaaaagaaaaacaatgcattactgaacaagttcaagccgttgaattgctagtacttgttgattatttggcggttctttttcg |
49684969 |
T |
 |
| Q |
314 |
gttaaatatattgttcagtc |
333 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49684970 |
gttaaatatattgttcagtc |
49684989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University