View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8999_high_3 (Length: 389)
Name: NF8999_high_3
Description: NF8999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8999_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 24 - 379
Target Start/End: Complemental strand, 44851549 - 44851194
Alignment:
| Q |
24 |
aagagaagatctattttgtcaatatggcttttttctatatttagtttgaaaggatcttcttggtctataatgatgtcctctgagcagtgtgttgtagatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851549 |
aagagaagatctattttgtcaatatggcttttttctatatttagtttgaaaggatcttcttggtctataatgatgtcctctgagcagtgtgttgtagatt |
44851450 |
T |
 |
| Q |
124 |
gtaagtaatgaaaattttcttcatttgtaacttgatcactactactcacagtgctcttattactgttaatctcctcttctacctgtttctgttcttggtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44851449 |
gtaagtaatgaaaattttcttcatttgtaacttgatcactactactcacagtgctcttattactgttaatctcctcttctacctgtttttgttcttggtt |
44851350 |
T |
 |
| Q |
224 |
ttcttccttagaagtaactgggagatctttggttgtttcggttttggattcttttggttgttgagctaaatttgtggtggaggagagggcagtgggatct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851349 |
ttcttccttagaagtaactgggagatctttggttgtttcggttttggattcttttggttgttgagctaaatttgtggtggaggagagggcagtgggatct |
44851250 |
T |
 |
| Q |
324 |
ggatggttatgtgttgaagtataggtgatgatgagcaatgaagcatctgtgctgct |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44851249 |
ggatggttatgtgttgaagtataggtgatgatgagcaatgaagcatctgtgctgct |
44851194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University