View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8999_low_16 (Length: 335)
Name: NF8999_low_16
Description: NF8999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8999_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 161 - 319
Target Start/End: Original strand, 4609241 - 4609399
Alignment:
| Q |
161 |
gcattgttttatgatttctgtggtgattgagacaaagatatttttgttggtataagtgaatagctttgcttgatttctacttctttgtctgctctcaaaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609241 |
gcattgttttatgatttctgtggtgattgagacaaagatattttggttggtataagtgaatagctttgcttgatttctacttctttgtctgctctcaaaa |
4609340 |
T |
 |
| Q |
261 |
ggtgggaaagtgttattctagattctttgttttttaagattcttaatgaaacagtgttc |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609341 |
ggtgggaaagtgttattttagattctttgttttttaagattcttaatgaaacagtgttc |
4609399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 4609091 - 4609142
Alignment:
| Q |
11 |
gaagcagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta |
62 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609091 |
gaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta |
4609142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University