View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8999_low_20 (Length: 255)
Name: NF8999_low_20
Description: NF8999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8999_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 35609593 - 35609350
Alignment:
| Q |
1 |
acaagattcagtacaagaattaaatcataaccattttcttcttcttctactactagttgtagttatgattatgaatgaatcttatgatcagaacatacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609593 |
acaagattcagtacaagaattaaatcataaccattttcttcttcttctactactagttgtagttatgattatgaatgaatcttatgatcagaacatacac |
35609494 |
T |
 |
| Q |
101 |
atgtcggtgcagctagctagagagacctaaatcagtacttcaaatttccaccatcgatctactttaccttaactcataaagtactgcaaattattaactc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609493 |
atgtcggtgcagctagctagagagacctaaatcagtacttcaaatttccaccatcgatctactttaccttaactcataaagtactgcaaattattaactc |
35609394 |
T |
 |
| Q |
201 |
caaacccatctcaacaataatcttcaccaccatggaacgtctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609393 |
caaacccatctcaacaataatcttcaccaccatggaacgtctct |
35609350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 35609636 - 35609594
Alignment:
| Q |
1 |
acaagattcagtacaagaattaaatcataaccattttcttctt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609636 |
acaagattcagtacaagaattaaatcataaccattttcttctt |
35609594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University