View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8999_low_25 (Length: 234)
Name: NF8999_low_25
Description: NF8999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8999_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 20818315 - 20818534
Alignment:
| Q |
1 |
gatcaatccaactcttgaaagccgactttgatgcattcacggtnnnnnnnnnnn-ccatcaaggttaaattcatactttgtcaatatacgattatgtgtt |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
20818315 |
gatcaatctaactcttgaaagccgactttgttgcattcacggtaaaaaaaataaaccatcaaggttaaattcatactttgtctatataagattatgtgtt |
20818414 |
T |
|
| Q |
100 |
tggtgggatatattttgatgtttattctatatgtctgattcacaaactagattctgcgttgctcatgtatcaacctcaattgatgttagtcttaatcaat |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818415 |
tggtgagatatattttgatgtttattctatatgtctgattcacaaactagattctgcgttgctcatgtatcaacctcaattgatgttagtcttaatcaat |
20818514 |
T |
|
| Q |
200 |
gtaaaacacaacataatatt |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20818515 |
gtaaaacacaacataatatt |
20818534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University