View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9000_high_16 (Length: 321)
Name: NF9000_high_16
Description: NF9000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9000_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 51378045 - 51378349
Alignment:
| Q |
1 |
actaaatatctcatttttcagaaactccatcagcacttgaccatcttctggaatatatactaccttgctatagattgaataaccacgaagtcccggcctg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378045 |
actaaatatcccatttttcagaaactccatcagcagttgaccatcttctgaaatatatactaccttgctatagattgaataaccacgaagtcccggcctg |
51378144 |
T |
 |
| Q |
101 |
taaagaacacttaccaatttagtccaagacatcaacacacaagccaccgtgcggaaagcctgccaccctgtgcaaggatgcacaagaaaccccttaactc |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51378145 |
taaggaacacttaccaatttagtccaagacatcaacacacaagccaccatgcggaaagcctgccaccctgtgcaaggatgcacaagaaaccccttaactc |
51378244 |
T |
 |
| Q |
201 |
tccgaataccatgttagagttgaatccatggtcatagagaggctgtgaaagctttcgatagcactctttctttaaatcaagagaaacatacgccaaccaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51378245 |
tccgaataccatgttagagttgaatccatggtcatagagaggctgtgaaagctttcgatagcactctttctttaaatcaagagaaacgtacgccaaccaa |
51378344 |
T |
 |
| Q |
301 |
ttaac |
305 |
Q |
| |
|
||||| |
|
|
| T |
51378345 |
ttaac |
51378349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University