View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9000_high_18 (Length: 297)
Name: NF9000_high_18
Description: NF9000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9000_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 8413838 - 8413548
Alignment:
| Q |
1 |
cactgctaccacggcctccacttgcacctgaacttgctcttgcaggactctttttcttctccccagaaaccttttctttgagcttcttgcgccatctcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413838 |
cactgctaccacggcctccacttgcacctgaacttgctcttgcaggactctttttcttctccccagaaaccttttctttgagcttcttgcgccatctcca |
8413739 |
T |
|
| Q |
101 |
taagccgatgatgtaaaaacaacaaaacagaactaatacgaaagctcctattgcaatgatgataaccaacacaatcaacctctttttgtccctattgtct |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413738 |
taagccgatgatgtaaaaacagcaaaacagaactaataagaaagctcctattgcaatgatgatgaccaacacaatcaacctctttttgtccctattgtct |
8413639 |
T |
|
| Q |
201 |
gtaccttcacactttgattccaatggcttcccacataaaccctgattatcagcaaatacagaagggttgttgaaccgtgatcccatagttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8413638 |
gtaccttcacactttgattccaatggcttcccacataaaccctgattatcagcaaataaagaagggttgttgaaccgtgatcccatagttt |
8413548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University