View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9000_low_32 (Length: 369)
Name: NF9000_low_32
Description: NF9000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9000_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 25 - 90
Target Start/End: Complemental strand, 44495272 - 44495207
Alignment:
| Q |
25 |
ctttcctcatacaacttaaccaattttttattttctccttcatgattttatctaaaacacttatat |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495272 |
ctttcctcatacaacttaaccaattttttattttctccttcatgattttatctaaaacacttatat |
44495207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University