View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9000_low_42 (Length: 315)
Name: NF9000_low_42
Description: NF9000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9000_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 102 - 295
Target Start/End: Complemental strand, 44040413 - 44040220
Alignment:
| Q |
102 |
gataatctagaaaagaacaatacctcaattgcatgggatagtgtttgttcctacaaattcaacaacataagaagcaatcagcagagtagttaattcatag |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44040413 |
gataatctagaaaagagcaatacctcaattgcatgggatagtgtttgttcctacaaattcaacaacataagaagcaatcagcagagtagttaattcatag |
44040314 |
T |
 |
| Q |
202 |
ttgataccttttatcattcagctttaagtatgcatggtaatcaagactaacccaaaaattatgtgaagttttcctcgtaattatatgcaccagt |
295 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44040313 |
ttgatatctttcatcattcagctttaagtatgcatggtaatcaagactaacccaaaaattatgtgaagttttcctcgtaattatatgcaccagt |
44040220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University