View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9000_low_63 (Length: 219)
Name: NF9000_low_63
Description: NF9000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9000_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 42792696 - 42792507
Alignment:
| Q |
14 |
caattatgataaccatcaaggcttttaaagtgtatatttgggatttatatctaaaaagtgggtttatggtggaccactttcatcgtcaattcagttatca |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42792696 |
caattgtgataaccatcaaggcttttaaagtgtatatttgggatttatatctaaaaagtgggtttatggtggaccactttcattgtcaattcagttatca |
42792597 |
T |
 |
| Q |
114 |
ttcaaaatatcaacaatggctgatgtatttcgtgaggtggtgaattgatttaggggtttctttcttactacctgtactggtccgaacaca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42792596 |
ttcaaaatatcaacaatggctgatgtatttcgtgaggtggtgaattgatttaggggtttctttcttactacctgtactggtccgaacaca |
42792507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University