View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9000_low_68 (Length: 211)
Name: NF9000_low_68
Description: NF9000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9000_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 40151991 - 40151808
Alignment:
| Q |
16 |
tctacaacagtggaagtgaaattcaaaatatgcttagcccaactcgttgtaaccattggcaagttgaccttcgctctgcctcaactatattggcgagagt |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40151991 |
tctacagcagtggaagtgaaattcaaaatatgcttagcccaactcgttgtaaccattggcaagttgaccttcgctctgcctcaactatattggcgagagt |
40151892 |
T |
 |
| Q |
116 |
agaagaactccgaggtggaatcgaagtagaagcagcaataccaacaaaggacggaagtcggcgtggtcagcctaacaccaccaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40151891 |
agaagaactccgaggtggaatcgaagtagaagcagcaataccaacaaaggacggaattcggcgtggtcagcctaacaccaccaa |
40151808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University